--- Day changed Thu Apr 23 2009
00:07 -!- genehacker [n=chatzill@wireless-128-62-98-46.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
00:48 < bkero> nom nom nom
00:51 < wrldpc> http://www.jewelinfo4u.com/Diamond_Mines.aspx?Mines
01:20 < fenn> i wonder if this feeling like i'm slowly dying is the normal feeling like i'm dying or due to a bad mango i ate
01:27 < katsmeow-afk> food poisoning can definitely make you feel death
01:42 < ybit> kanzure, why not instead of creating a mailing list, just setup an rss feed of new papers you add to the collection?
01:44 < ybit> also of note: lxml
01:44 < ybit> http://www.ibm.com/developerworks/xml/library/x-hiperfparse/
01:49 < ybit> ..or maybe just setup a page to view the git log for biotech toolkit?
01:50 < ybit> i guess the mailing list could work since it allows for feedback
02:00 -!- any22156021 [n=someone@75-120-216-168.dyn.centurytel.net] has joined #hplusroadmap
02:04 -!- katsmeow-afk [n=someone@75-120-45-59.dyn.centurytel.net] has quit [Read error: 60 (Operation timed out)]
02:17 -!- duzt is now known as duzt|s133p
02:21 -!- any15162617 [n=someone@75-120-47-194.dyn.centurytel.net] has joined #hplusroadmap
02:27 -!- any22156021 [n=someone@75-120-216-168.dyn.centurytel.net] has quit [Read error: 60 (Operation timed out)]
07:31 -!- elias` [n=me@unaffiliated/elias/x-342423] has quit [Read error: 145 (Connection timed out)]
07:31 -!- jm [n=jm@p57B9CC17.dip.t-dialin.net] has joined #hplusroadmap
07:39 -!- elias` [n=me@cs78208074.pp.htv.fi] has joined #hplusroadmap
07:56 < kanzure> "standard disclaimer: welcome to bryan's brain. he probably doesn't know it, but he's already beginning to neglect you. if you want to keep up, you will need to yell at him extensively for the IRC channels, RSS feeds, emails, etc., to keep up with him."
07:56 < kanzure> :/
07:57 < kanzure> why isn't there an automatic feedback mechanism built into RSS
07:57  * kanzure hunts down aaron swartz
07:58 < faceface> kanzure: you heard of DAS?
07:58 < faceface> Distributed annotation system
07:59 -!- faceface is now known as pingface
08:06 < kanzure> ok, I've added RSS back to heybryan.org
08:06 < kanzure> enjoy.
08:08 < pingface> there is also a protocol called 'das writeback' for commenting on a das annotation
08:10 < UtopiahGHML> pingface: probably a bit different but ShiftSpace http://www.shiftspace.org/ is interesting 
08:18 -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has quit []
08:19 -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has joined #hplusroadmap
08:22 < pingface> UtopiahGHML: right
08:26 -!- pingface is now known as faceface
09:03 -!- kanzure- [n=bryan@66.112.232.230] has quit ["leaving"]
10:52 -!- duzt|s133p is now known as duzt
11:11 < kanzure> haha, I like how sonoluminescence has like 1% efficiency of mechanical energy into light
11:11 -!- jm|space [n=jm@p57B9C821.dip.t-dialin.net] has joined #hplusroadmap
11:12 -!- kanzure- [n=bryan@66.112.232.230] has joined #hplusroadmap
11:28 -!- jm [n=jm@p57B9CC17.dip.t-dialin.net] has quit [Read error: 110 (Connection timed out)]
11:36 -!- duzt is now known as duzt|shower
11:39 -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has quit []
11:43 -!- jelleferinga [n=jellefer@49.166.101-84.rev.gaoland.net] has joined #hplusroadmap
11:44 -!- jelleferinga [n=jellefer@49.166.101-84.rev.gaoland.net] has quit []
11:51 -!- duzt|shower is now known as duzt
11:51 -!- any15162617 is now known as katsmeow-afk
12:40 < kanzure> http://heybryan.org/books/papers/%20In%20situ%20DNA%20synthesis%20on%20glass%20substrate%20for%20microarray%20fabrication%20using%20self-focusing%20acoustic%20transducer.pdf
12:40 < kanzure> DNA synthesis microfluidic device using piezos
12:42 < kanzure> using only four piezos
12:42 < kanzure> hrm
12:46 < kanzure> heh they mechanically rotate the entire device around so that they can manually do the washing / deblocking steps for phosphoramidite synthesis
12:48 < kanzure> droplets are continuously ejected for a minute each? hrm.
12:52 < xp_prg> kanzure I so enjoy microfluidics, I can't wait to see something practical to use for bio tech experiments at the diybio level
12:52 < kanzure> I think the first thing that might come is DNA synthesis, or possibly PCR
12:53 < kanzure> I'm looking at this design and it doesn't make much sense
12:53 < kanzure> the idea is to use resevoires of nucleotides and to them cause droplets to move out of them and into a synthesis chamber
12:53 < kanzure> but then why are all of these microchannels intersecting each other. hrm.
12:54 < xp_prg> do you feel there are any practical microfluidic type usage at the diybio level yet?
12:54 < kanzure> oh. it's for producing *only* 3x3 DNA probes haha
12:54 < kanzure> yes, of course
12:54 < kanzure> PCR, dna synthesis, dna sequencing, etc. etc.
12:54 < xp_prg> it would be amazing to know those in detail, I would begin to use them for diybio-sf
12:55 < kanzure> http://heybryan.org/books/papers/microfluidics/
12:55 < kanzure> start reading :)
12:55 < xp_prg> ok
12:56 < kanzure> here's an easy design for PCR: http://heybryan.org/books/papers/microfluidics/gkm389%20Miniaturized%20PCR%20chips%20for%20nucleic%20acid%20amplification%20and%20analysislatest%20advances%20and%20future%20trends.pdf
12:56 < kanzure> it's a spiral, and at the four corners of the plate you put heating/cooling elements
13:27 < kanzure> hrm
13:27 < kanzure> "to have an idea of who you are.. ask me for a microlfuidics device that would useful for you adn i will make itwork and send it to you for free (and so you can see what i do).. i will only do the microfluidics working device (no electrical connections or computer interface). you can use any designing software that you wish..ok?"
13:52 < kanzure> wonder what would be the best way to recover high density oligonucleotide arrays synthesized on a microfluidics chip
13:52 < kanzure> especially if it's not an open-air system
13:53 -!- wrldpc [n=worldpea@c-76-19-107-75.hsd1.ma.comcast.net] has joined #hplusroadmap
13:56 -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap
13:57 < genehacker> can you get him to tell us the smalllest feature size we can get?
13:57 < genehacker> kanzure
13:57 < genehacker> I'd like to know the smallest feature size that diybio guy will give us
13:57 < kanzure> okay
13:57 < kanzure> 20 microns
13:58 < genehacker> that sounds pretty damn big
13:58 < genehacker> I have preexisting designs for a logic gates
13:59 < genehacker> I found a patent for a fluidic credit card reader and a couple fluidic registers
13:59 < kanzure> you don't have any designs already on your hard drive for anything relatively complete?
13:59 < genehacker> we can copy the circuit diagram and downsize it
14:00 < genehacker> the closest thing I have to relatively complete  is a fluidic amplifier silhouete
14:00 < kanzure> what does it amplify?
14:00 < genehacker> sound
14:01 < kanzure> okay
14:01 < kanzure> sounds good to me
14:01 < genehacker> http://www.dself.dsl.pipex.com/MUSEUM/COMMS/fluidicgramophone/fluidgram.htm
14:01 < genehacker> it's in gif
14:02 -!- wrldpc [n=worldpea@c-76-19-107-75.hsd1.ma.comcast.net] has quit []
14:03 < genehacker> hey you said you designed microcontroller right?
14:05 < kanzure> that's true.
14:05 < genehacker> this one has dimensions
14:05 < kanzure> what?
14:05 < genehacker> http://ieeexplore.ieee.org/stamp/stamp.jsp?tp=&arnumber=494010
14:05 < kanzure> blah..
14:05 < genehacker> here's an actual design
14:05 < kanzure> I just sent the fluidic amplifier design
14:06 < genehacker> cool
14:06 < genehacker> so how does your microcontroller work?
14:06 < kanzure> one thing I designed a long time ago was a simple 4 bit microprocessor
14:07 < kanzure> so it had some basic arithmetic logic units for add, subtract, multiply, etc.,
14:07 < kanzure> and then some logic elements to recognize instructions, read from the instruction buffer memory, etc.
14:07 < kanzure> very very basic
14:08 < genehacker> how many logic gates did it use?
14:10 < kanzure> I don't know if I ever generated the final schematics, I was mostly just programming in Verilog or something
14:10 < xp_prg> kanzure I suggested the simple pcr on diybio and they are open but feel it could be too difficult can you help explain why it is easy/possible?
14:10 < xp_prg> with microfluidics
14:10 < kanzure> why do they feel it would be too difficult?
14:10 < genehacker> what does programming in verilog look like?
14:10 < xp_prg> cons: we have to figure out how to design the fluidic circuit, the heater/cooler, what materials to use, how to clean between samples, how to actually build it, and finally, how to integrate a visualiser so we can still do qPCR
14:10 < xp_prg> I am down for doing this, but is it really going to be possible with our means?
14:11 < genehacker> we're talking about making a microfluidic graphing calculator
14:11 < genehacker> someone's offering to make any microfluidic device for us for free
14:12 < xp_prg> wow cool!
14:12 < xp_prg> who is this person?
14:12 < genehacker> someone from diybio
14:12 < xp_prg> well who?
14:12 < xp_prg> where are they located?
14:12 < genehacker> the only caveat is that we can't use electrical devices
14:14 < genehacker> no idea who
14:14 < genehacker> Nanoscience technology is their post name
14:14 < xp_prg> oh I did see that post
14:16 < xp_prg> kanzure please respond to the thermocycler diybio thread
14:16 < kanzure> xp_prg: with what
14:16 < xp_prg> with an argument addressing the concern with a microfluidic pcr approach
14:17 < kanzure> at this point I think it would be better to go with the more traditional design because people already know how that works
14:17 < kanzure> I'm more interested in working on a DNA synthesizer or something
14:17 < kanzure> which might actually be simpler
14:17 < genehacker> damn good point
14:17 < kanzure> genehacker: so I think I can design a DNA synthesizer
14:17 < kanzure> but
14:18 < kanzure> what I don't know how to do is get it so that all of the samples are easily accessible
14:18 < kanzure> consider for instance if there was a 2-plate sandwich DNA synthesizer
14:18 < kanzure> made out of microfluidic channels and such
14:18 < kanzure> how would samples be recovered
14:20 < kanzure> one idea is to use a straw with emulsions so that you literally drain the DNA into the straw, and then cap it with oil or something on either side
14:20 < kanzure> and then you number the slots in the straw
14:20 < kanzure> and then you poke a hole when you want to drain it or something :p
14:20 < genehacker> cut copy paste
14:20 < kanzure> ?
14:20 < genehacker> IE integrate a PCR step
14:20 < kanzure> cut what?
14:20 < kanzure> so wait
14:20 < kanzure> what about for synthesizing multiple strands at once
14:21 < kanzure> not just synthesizing the same strand a million times 
14:21 < kanzure> I guess doing the same sequence a million times would be fine
14:21 < kanzure> then you could mix it together
14:21 < kanzure> but where do you send it
14:21 < genehacker> just copy the final combined product over and over again
14:21 < genehacker> http://www.youtube.com/watch?v=JvDZh8hmR84&feature=related
14:21 < kanzure> where do you put it?
14:21 < genehacker> sharpie microfluidic based DNA sequencer
14:21 < genehacker> er... droplet based
14:22 < genehacker> well I have to go, lets figure out some way we can design microfluidic circuits
14:23 < genehacker> something like verilog
14:23 < kanzure> sure
14:23 < kanzure> but I still need to know where to *put* the products
14:26 < kanzure> genehacker: if you work for campbell over the summer we could get that verilog thingy working actually
14:28 < kanzure> ok guess we could do a drill-through screw-on-cap container drain dealy
14:38 -!- wrldpc_ [n=worldpea@pool-72-85-179-84.bstnma.east.verizon.net] has joined #hplusroadmap
14:48 -!- wrldpc_ [n=worldpea@pool-72-85-179-84.bstnma.east.verizon.net] has quit []
14:57 -!- splicer [n=patrik@h10n1c1o261.bredband.skanova.com] has joined #hplusroadmap
15:00 -!- wrldpc [n=worldpea@c-66-30-12-190.hsd1.ma.comcast.net] has joined #hplusroadmap
15:02 < kanzure> hrm I think I've designed a non-reprogrammable (or non-programmable) DNA synthesizer
15:02 < kanzure> it only synthesizes the specific sequence it was made to synthesize
15:04 -!- wrldpc [n=worldpea@c-66-30-12-190.hsd1.ma.comcast.net] has quit [Client Quit]
15:41 < kanzure> so, I need to figure out how to properly do scheduling of droplet movements
15:42 < kanzure> just do rapid switching between interrupts? erm. so there's something like 500 elements that move the droplets
15:42 < kanzure> each one can be addressed individually
15:42 < kanzure> when one is switched on (adjacent to the last one), the droplet moves towards the one that is switched on
15:43 < kanzure> I mean, will I be shot for not writing a proper task manager?
16:02 < fenn> i've got quite a dependency tree built up before i can get a driver's license (before mine expires next week)
16:02 < kanzure> eh?
16:02 < kanzure> things to do?
16:02 < fenn> things i didnt know i had to do
16:03 < kanzure> ok, now stand on your head
16:03 < kanzure> or else
16:03 -!- duzt [n=duzt@dsl093-216-054.aus1.dsl.speakeasy.net] has quit []
16:03 < fenn> i don't think it's all going to happen
16:04 < kanzure> "Bryan, I realized I'm not quite clear on the title of your role at DIYbio. Co-founder, contributor, guru?"
16:09 < fenn> this was the crayon sketch thingy i was trying to remember http://www.dgp.toronto.edu/~shbae/ilovesketch.htm
16:25 < kanzure> "enormous prick"
16:25 < kanzure> aw :(
16:28 < fenn> is that a compliment?
16:28 < kanzure> I don't think so
16:29 < kanzure> they didn't say that
16:29 < kanzure> I'm just expecting something un-nice
16:38 < fenn> i'm getting lots of spam email lately, mostly penis enlargement and related stuffs
16:50 < kanzure> http://bioweathermap.org/ released
17:04 < kanzure> ok, some diagrams of schemes for DNA synthesis with droplets
17:04 < kanzure> http://heybryan.org/~bbishop/docs/DNAsynthesizer/
17:28 < kanzure> fear my mad diagramming skills.
17:37 < fenn> i think i'm going to give up on life and go back to my parent's house
17:37 < kanzure-> depressed?
17:38 < fenn> i don't know.. 
17:39 < fenn> yesterday i wanted to go to the shop and work on stuff but i had to lay down.. for like 8 hours
17:39 < kanzure-> weren't you feeling sick?
17:40 < fenn> it was just sort of more intense version of the usual
17:40 < fenn> anyway, i guess i don't have whatever it takes to keep my shit together
17:40 < kanzure-> somebody yell at you?
17:40 < fenn> there's no way i'm going to get all this stuff to fix my car
17:41 < kanzure-> you mean, a license?
17:41 < fenn> i have to buy a new tail light and brake cylinder, install them, insurance
17:42 < fenn> need ^^ and social security card to get a license, my license expires on may 2nd
17:42 < fenn> oh i also have to register the title and pay a 'new resident tax' which is $90
17:42 < kanzure-> resident tax??
17:42 < fenn> and steve doesn't have money to pay me for another couple weeks
17:43 < fenn> so anyway, without a car i'm just a drag on les
17:43 < fenn> that's the logic at least
17:43 < fenn> i've been struggling to keep up for about a year though
17:43 -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
17:43 < kanzure-> KEEP WHAT UP?
17:43 < kanzure-> erm, caps lock
17:44 < kanzure-> so what happened to the idea of selling the car and getting something else?
17:44 < fenn> was that an idea i had?
17:44 < kanzure-> when you were thinking of coming down
17:45 < fenn> there was some guy who left a note on the door a couple weeks ago expressing interest in buying the car
17:45 < kanzure-> did you have a sign on it?
17:45 < fenn> no
17:45 < kanzure-> is that usual behavior of people?
17:45 < fenn> but i really like that car and don't expect to find another
17:45 < kanzure-> to put notes on things expressing interest in buying it?
17:45 < fenn> i guess CRX's are popular with mexicans
17:46 < fenn> it's been sitting in les' driveway and i don't go places very often, so it's possible he thought it wasn't being driven at all
17:47 < kanzure-> is les paying you anything?
17:47 < fenn> i did some metalworking stuff for a couple days and he mumbled something about 'maybe i'll give you a couple months rent at the shop'
17:47 < fenn> but i haven't brought it up
17:48 < kanzure-> other than that though?
17:48 < fenn> no
17:48 < fenn> he is letting me stay in his house rent free though
17:48 < kanzure-> worst case scenario you can get a job with my mom but the gas will kill you
17:49 < kanzure-> she's out in Kyle, Tx
17:50 < kanzure-> well, her shop is actually in Lockhart, Tx
17:51 < kanzure-> alternatively you could make some rounds with me here at the labs if you want, 
17:51 < kanzure-> there's a way to make this work.
17:51 < fenn> do you really think they'd hire me at one of the labs?
17:52 < fenn> also there's more to this than just money
17:52 < kanzure-> yes
17:54  * fenn goes to fill out a return to manufacturer authorization form for his body
17:54 < kanzure-> if the not-getting-your-shit-together is just a matter of money, then that's solved
17:55 < fenn> one hypothesis for why i don't have a good steady job already is that i'm "addicted to the internet"
17:55 < kanzure-> according to who?
17:55 < fenn> but i don't think this is correct because i did an experiment
17:55 < kanzure-> oh?
17:56 < fenn> according to me, based on sensationalist media about the dangers of technology
17:56 < kanzure-> is it possible that you just haven't found an interesting job
17:56 < fenn> about a year ago (?) i moved into my friend rob's house.. rob lives way out in the country with dialup.. basically impossible to use the net, so i didnt
17:56 < kanzure-> er, what did you do ?
17:57 < fenn> absolutely nothing
17:57 < kanzure-> sounds boring
17:57 < fenn> i stared at the ceiling
17:57 < fenn> and my sleep phase was still off
17:57 < fenn> oh, and i worked on my car because it needed a new water pump
17:58 < kanzure-> so again, is it possible that you just haven't found an interesting job [that pays]
17:58 < fenn> that was when i realized i was basically stuck there without my car, and i'd have to drive anywhere to do anything or see any people (rob travels a lot), so i moved back into the old house
18:00 < fenn> even though i have a pile of projects i haven't gotten around to doing them
18:00 < kanzure-> do you have the resources to make them happen?
18:00 < fenn> so it'd be hard to find a more interesting job
18:01 < fenn> i have all the pieces necessary, yes
18:01 < kanzure-> wait, really?
18:01 < fenn> well, sort of.. i still need to con les out of his laser printer so i can etch circuit boards, but that doesn't stop me from doing the layout or whatever
18:01 < kanzure-> for what?
18:02 < fenn> the cnc motor drivers
18:02 < kanzure-> oh. pcb boards for them.
18:02 < fenn> which i've been talking about since 2005
18:02 < kanzure-> sometimes thinking is hard for me. it's like squeezing out a thought or something.
18:02 < kanzure-> tools sometimes make it easier or something
18:02 < kanzure-> but it's always even more easy if somebody threw up a script to do it or something
18:02 < fenn> i can write my own script
18:03 < kanzure-> well, script as in .. erm ..
18:03 < kanzure-> not for the shell.
18:03 < kanzure-> but for doing things
18:03 < fenn> todo list, with bullet points
18:03 < kanzure-> just because it's on a list doesn't mean you'll get it done
18:03 < kanzure-> or that I'll get it done for that matter
18:03 < fenn> exactly
18:03 < kanzure-> so here's a theory
18:03 < kanzure-> with a limited set of bullets on a page
18:03 < fenn> i can make a detailed list but i won't do it
18:03 < kanzure-> some percentage of them will get done by at least one of us
18:04 < kanzure-> is it possible to make it so that we both do the other things that we won't do
18:04 < kanzure-> heh'
18:04 < kanzure-> or would that just make some sort of tri-combination of terribleness
18:04 < fenn> yes it's possible but there's interpretation issues
18:04 < fenn> much easier to do something you understand than to explain it to someone else
18:04 < kanzure-> well, if you understand it, then you should be able to explain it (supposedly)
18:05 < kanzure-> that's sometimes where I get worked up. recursing through the tree of explanations
18:05 < kanzure-> or bush of explanations
18:05 < kanzure-> gee, you know what would be useful here ..
18:05 < fenn> skdb wouldn't be useful here
18:06 < kanzure-> why's that?
18:06 < fenn> except for maybe letting me know a month ago i had to do all this crap to get my driver's license 
18:06 < kanzure-> oh. btw. there's a renew-your-license-over-the-web dealy here in texas
18:07 < fenn> not for out of state license
18:07 < fenn> did you know they take your thumbprints?
18:08 < kanzure-> yes
18:13 < kanzure-> so when I turned 18, I started ranting around asking for a 'guidebook to stuff that the state needs to tell you now that you're 18"
18:14 < kanzure-> but nobody keeps that sort of documentation
18:15 < kanzure-> anyway, keep me in the loop. I think you're more useful here than there.
18:24 < fenn> well my idea was to go there and have them spend lots of money for me to go to various doctors, then i'll be fixed, and capable of actually doing stuff
18:25 < kanzure-> do you have healthcare insurance?
18:25 < fenn> i don't actually have much faith in doctors but it might be something simple
18:25 < fenn> no, i don't have health insurance
18:25 < kanzure-> ah, well then.
18:25 < fenn> dad was supposed to be setting that up but i guess he never finished
18:25 < kanzure-> do you have to go there for them to get you health care?
18:25 < kanzure-> you should probably poke him about that before you physically move
18:26 < kanzure-> and if you want you can always try what they're forcing down my throat these days. it seems to do, something
18:26 < fenn> what's that, adderall?
18:27 < kanzure-> yes. 5 mg, 10 mg, and 30 mg. and I'm also on prozac now, but I don't know what it's doing and wouldn't recommend it.
18:27 < fenn> why are you on prozac?
18:27 < kanzure-> the doctor thinks I'm depressed
18:27 < kanzure-> and honestly it's because mom says dad thought I was depressed
18:27 < kanzure-> (she said that to the doctor)
18:28 < fenn> der... woah
18:28 < kanzure-> yeah ..
18:28 < kanzure-> he also thinks I have OCD, but that's not as bad as thinking I'm depressed
18:28 < kanzure-> he's actually a bright guy. just don't agree about the depression stuff.
18:29 < kanzure-> besides, it's one of those medications that takes a while to build up into the system
18:29 < kanzure-> adderall will be working in 15 to 30 minutes.
18:47 < kanzure-> um. so any ideas on making an oligonucleotide array but out of 2D channels for microfluidics operations?
18:47 < kanzure-> without intersecting lines
18:48 < kanzure-> I guess with electrowetting you don't need to have channel walls
18:58 -!- DrTread [n=irchon@71.145.152.176] has joined #hplusroadmap
18:59 -!- xp_prg [n=xp_prg3@99.2.31.217] has quit ["This computer has gone to sleep"]
18:59 < DrTread> FYI I'm showing off the MakerBot kit @ the robot group tonite. 
19:00 < fenn> where's that?
19:00 < DrTread> south mopac
19:00 < kanzure-> wah.
19:00 < kanzure-> are you going to come and get me?
19:01 < DrTread> Heritage at Gaines Ranch retirement home
19:01 < fenn> ah good, i think i'll go
19:01 < DrTread> yes. for reals?
19:01 < kanzure-> I would appreciate a ride :)
19:01 < DrTread> where u @?
19:01 < kanzure-> 24th and Guadalupe.
19:02 < kanzure-> http://maps.google.com/maps?f=q&source=s_q&hl=en&geocode=&q=2323+San+Antonio+St,+Austin,+TX+78705&sll=37.0625,-95.677068&sspn=14.70541,65.302734&ie=UTF8&ll=30.297425,-97.742443&spn=0.007781,0.031886&t=h&z=15&iwloc=r0
19:02 < kanzure-> aren't you north of austin?
19:02 < DrTread> ok. I'm leaving here in 10 min
19:02 < kanzure-> do you have my number?
19:02 < DrTread> east south east
19:02 < kanzure-> oh
19:02 < DrTread> I think so. 
19:02 < kanzure-> if I'm out of your way then don't bother
19:03 < kanzure-> thought you were north
19:03 < DrTread> but I want to get you! *pouts*
19:03 < kanzure-> okay
19:04 < kanzure-> fenn: will you be there?
19:05 < fenn> yep
19:09 -!- DrTread [n=irchon@71.145.152.176] has quit []
19:11 -!- DrTread [n=irchon@71.145.152.176] has joined #hplusroadmap
19:11 < kanzure-> soo it looks like we just need algorithms for moving droplets over surfaces in some optimal way
19:11 < kanzure-> and then some way to make more droplets from a resevoire
19:11 < DrTread> kanzure on my iPhone now. plz resend coordinates. 
19:11 < kanzure-> pyrosequencing
19:11 < kanzure-> erm
19:12 < kanzure-> http://maps.google.com/maps?f=q&source=s_q&hl=en&geocode=&q=2323+San+Antonio+St,+Austin,+TX+78705&sll=37.0625,-95.677068&sspn=14.70541,65.302734&ie=UTF8&ll=30.297425,-97.742443&spn=0.007781,0.031886&t=h&z=15&iwloc=r0
19:13 -!- DrTread_ [n=irchon@cpe-70-112-223-97.austin.res.rr.com] has joined #hplusroadmap
19:14 < DrTread_> crap. as soon as I walk out of wifi range, the map disappears. email coordinates, plz
19:14 < kanzure-> um, one moment
19:14 < kanzure-> basically search for "The Castilian"
19:15 < kanzure-> it's at 24th and San Antonio or 24th and Guadalupe (the main intersection)
19:17  * fenn departs
19:17 < kanzure-> http://cgi3.ebay.com/ws/eBayISAPI.dll?ViewUserPage&userid=dna_for_charity
19:18 < kanzure-> bidding starts at $68k for whole genome sequencing by Knome
19:18 < kanzure-> includes private dinner with Church
19:18 < kanzure-> should I take out a loan and bid $100k?
19:20 -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap
19:29 -!- DrTread__ [n=irchon@166.133.78.80] has quit [Remote closed the connection]
19:29 -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap
19:31 -!- DrTread [n=irchon@71.145.152.176] has quit [Read error: 110 (Connection timed out)]
19:34 -!- DrTread_ [n=irchon@cpe-70-112-223-97.austin.res.rr.com] has quit [Read error: 110 (Connection timed out)]
19:34 < bkero> Sure
19:36 < kanzure> ?
19:36 < kanzure> will you give me the $100k?
19:37 -!- DrTread__ [n=irchon@166.133.78.80] has quit []
19:37 -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap
19:37 -!- DrTread__ [n=irchon@166.133.78.80] has quit [Remote closed the connection]
19:37 -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap
19:37 < kanzure> DrTread__: have you left?
19:37 < kanzure> genehacker: want to see a makerbot tonight?
19:37 -!- DrTread [n=irchon@166.133.78.80] has joined #hplusroadmap
19:37 < kanzure> DrTread: have you left?
19:38 < DrTread> I'm in Austin now
19:38 < DrTread> eta 7:51
19:42 < genehacker> MAKERBOT WHERE?
19:42 < genehacker> AUUUUAUAGUCUACUACUCAUGAAGGUGCUAUGGAA
19:42 < genehacker> translate to protein
19:42 < kanzure> genehacker: where are you?
19:43 < genehacker> in my dorm
19:43 < genehacker> where are you?
19:43 < kanzure> if you come to my dorm maybe you can hitch a ride with me
19:43 < kanzure> within the next five minutes
19:43 < genehacker> how long will it take?
19:43 < kanzure> possibly until 11
19:43 < genehacker> where are we going?
19:43 < kanzure> I'm going to the robot group meeting
19:43 < kanzure> DrTread is picking me up
19:43 < genehacker> hmmmm...
19:43 -!- DrTread [n=irchon@166.133.78.80] has quit []
19:43 < genehacker> choices choices
19:43 < kanzure> at least stop by and say hello
19:43 < genehacker> do you think they'd let me work on stuff there?
19:44 < genehacker> like my homework
19:44 < genehacker> ?
19:44 < genehacker> ah screw it
19:44 < genehacker> I'm going 
19:44 < kanzure> yeah sure
19:44 < genehacker> I don't have that much
19:44 < genehacker> AUUUUAUAGUCUACUACUCAUGAAGGUGCUAUGGAA
19:52 -!- DrTread [n=irchon@166.133.18.32] has joined #hplusroadmap
19:52 -!- DrTread [n=irchon@166.133.18.32] has quit [Remote closed the connection]
19:58 -!- truename [n=truename@c-76-125-146-206.hsd1.pa.comcast.net] has quit [Read error: 110 (Connection timed out)]
20:05 -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
21:06 < katsmeow-afk> titanium nanotubes contaminated with potassium split water to hydrogen with 1/3 the electricity as uncontaminated : http://www.eurekalert.org/pub_releases/2009-04/nios-doa042309.php
21:17 < katsmeow-afk> how to punch nanoholes in cell membranes : The paper is called "Amyloid-beta-induced ion flux in artificial lipid bilayers and neuronal cells: Resolving a controversy."
21:27 < ybit> w00t rss feeds :P
23:41 < ybit> http://www.darpa.mil/dso/programs.htm#m
23:41 < ybit> "Mathematical Time Reversal "
23:49 < kanzure> well now.
23:49  * kanzure gawks at tool list
23:51 -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap
23:52 < kanzure> genehacker: hey
23:52 < kanzure> the interview will be published Monday
23:52 < genehacker> what will?
23:52 < kanzure> the interview with singularity hub about diybio
23:53 < genehacker> hmmm