--- Day changed Mon Sep 14 2009
01:19 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit []
01:21 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap
01:59 -!- genehacker2 [i=genehack@128.62.34.238] has quit [Read error: 145 (Connection timed out)]
04:09 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 110 (Connection timed out)]
05:19 -!- Phreedom_ [n=quassel@195.216.211.175] has joined #hplusroadmap
05:19 -!- Phreedom [n=quassel@195.216.211.175] has quit [Read error: 104 (Connection reset by peer)]
05:40 -!- Phreedom_ [n=quassel@195.216.211.175] has quit [Read error: 113 (No route to host)]
06:04 -!- Phreedom [n=quassel@195.216.211.175] has joined #hplusroadmap
07:09 -!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: davidnunez__
07:11 -!- Netsplit over, joins: davidnunez__
07:55 -!- genehacker [i=genehack@wireless-128-62-180-131.public.utexas.edu] has joined #hplusroadmap
08:00 -!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: davidnunez__
08:01 < kanzure> fenn: why is paul smashing together revision control into his pointrel project?
08:01 < kanzure> it seems like he's munging a lot of different things together needlessly
08:01 -!- Netsplit over, joins: davidnunez__
08:03 < fenn> "I'm curious if your local robotics group is in a frenzy? Things from the virtual end look as if they are really kickn in that area."
08:03 < fenn> hmm how do people get these flawed perceptions i wonder
08:04 < kanzure> maybe he meant "kickin the bucket"
08:04 < kanzure> that would be closer to the truth
08:04 < fenn> zero status updates or evidence of activity for 5 months == really kickn
08:05 < kanzure> pay me $100,000 
08:10 < fenn> it's called "investment"
08:19 -!- genehacker [i=genehack@wireless-128-62-180-131.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
08:42 < kanzure> fenn: did we ever test Point(TopoDS_Vertex()) ?
08:47 < kanzure> the other day i was doing TopoDS_Vertex() -> Point for some reason
08:47 < kanzure> guess i didn't merge
08:47 < kanzure> Point(BRep_Tool.Pnt(TopoDS_Vertex()))
08:47 < kanzure> is there a way to do that with OCC_triple fenn?
08:48 < kanzure> oops, it was: Point(BRep_Tool().Pnt(TopoDS_Vertex()))
08:48 < kanzure> huh that leads to a segmentation fault
08:53 < kanzure> for the record I had the code in the make_point function in import_tools/surf.py
08:58 < fenn> TopoDS_Vertex() points to nothing, essentially, so when you try to do a cast, it accesses some random memory location. make sense?
08:59 < kanzure> yep
09:02 < kanzure> vertex is a TopoDS_Vertex
09:02 < kanzure> location = vertex.Location()
09:02 < kanzure> location.IsDifferent(location.__class__())==1
09:03 < kanzure> (I do that because I don't have TopLoc_Location imported and i'm lazy)
09:03 < kanzure> but it's always 0
09:03 < kanzure> so this tells me that these vertices aren't being given any values
09:11 < kanzure> ah guess I have to explore wires
09:51 -!- genehacker [i=genehack@wireless-128-62-175-44.public.utexas.edu] has joined #hplusroadmap
09:58 -!- mason_l [n=x@202-89-188-136.static.dsl.amnet.net.au] has joined #hplusroadmap
10:02 -!- mason-l [n=x@202-89-188-136.static.dsl.amnet.net.au] has quit [Read error: 110 (Connection timed out)]
10:03 < fenn> http://fabfi.fablab.af/stats.php
10:06 < kanzure> why can't you add two dictionaries together?
10:06 < kanzure> dictionary1.extend or dictionary1.append or dictionary1.add would be nice to have
10:10 -!- mason_l is now known as mason-l
10:10 < fenn> um, those methods exist
10:11 < kanzure> where?
10:11 < fenn> sorry it's called update
10:11 < kanzure> blah
10:12 < kanzure> how do you determine whether or not to overwrite the dictionary?
10:12 < kanzure> I mean, if there's a key conflict
10:12 < kanzure> I guess there's "setdefault"
10:16 < fenn> what's "setdefault"?
10:17 < fenn> i guess it's whether you do a.update(b) or b.update(a)
10:23 < fenn> "The dot option corresponds to attributed dot output, and is the default output format. "
10:23 < fenn> they add layout attributes to the existing dot file, hence "ATtributing"
10:35 -!- genehacker [i=genehack@wireless-128-62-175-44.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
10:42 -!- genehacker [i=genehack@128.62.34.238] has joined #hplusroadmap
10:53 -!- superkuh_ [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap
11:17 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Read error: 110 (Connection timed out)]
11:25 < fenn> hmm how did it become monday already
11:26 < kanzure> saturday ate friday and sunday looked the other way
11:26 < fenn> damn you sunday!
11:36 -!- xp_prg [n=xp_prg3@c-67-188-6-132.hsd1.ca.comcast.net] has quit ["This computer has gone to sleep"]
11:46 < genehacker> the arrow of time
11:55 -!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has quit []
11:55 < kanzure> what's the control code for the windows newline '^M' ?
11:55 < kanzure> escape sequence, sorry
11:55 < kanzure> I guess it's \r
11:55 < genehacker> ???
11:55 < genehacker> try sacrificing a goat
11:56 < genehacker> sometimes it works
11:56 < fenn> jesus hates you
11:56 < fenn> RTFM
11:57 < kanzure> on a related note, BRepTools_WireExplorer worked when it wasn't OOified, but now that it is, it's not? wtf?
11:57 < kanzure> explorer.More() is telling me there are no more points 
11:58 < kanzure> but .. but..
11:58 < genehacker> why are you using winblows anyway?
11:58 < kanzure> pythonOCC is written by windorks
11:58 < kanzure> so they save these stupid files without any newlines
11:58 < kanzure> so it's all on one line
11:58 < kanzure> had to do a regular expression to fix their shit
11:58 < kanzure> wonder if windows 7 fixes this. my guess is no.
11:59 < genehacker> windows 7 takes 20 hours to install
12:02 -!- xp_prg [n=xp_prg3@99.2.31.217] has joined #hplusroadmap
12:06 < kanzure> http://adl.serveftp.org/~bryan/screenshots/2009-09-14_brep_approximation.png
12:07 < kanzure> not quite, huh
12:08 < genehacker> what's that weird line?
12:09 < kanzure> the program takes in a mesh and converts it into a point cloud
12:09 < kanzure> in this case the mesh is a cube
12:09 < kanzure> the weird line is an attempt at a boundary representation
12:09 < kanzure> i'm doing something wrong (i know what it is)
12:13 < fenn> looks like one correct control point and a bunch of random control points
12:13 < kanzure> well i'm assuming the mesh is a single face
12:14 < fenn> maybe you shouldnt start out with a cube then :)
12:14 < kanzure> blasphemy!
12:14  * kanzure throws a rancor at fenn
12:15 < fenn> so fablab.af is no more?
12:15 < kanzure> works for me
12:15 < kanzure> check your /etc/hosts 
12:15 < kanzure> did you set it to be me?
12:15 < fenn> http://blog.fablab.af/?paged=2
12:15 < fenn> oh it moved
12:15 < fenn> nm
12:16 < kanzure> not a bad living arrangement: http://scripts.mit.edu/~emu/fab/wp-content/uploads/2009/08/beds.jpg
12:16 < kanzure> however the computer in the room is weird
12:16 < kanzure> guess they're all awake at the same time
12:17 < kanzure> and where'd they find matching bed spreads anyway?
12:18 < genehacker> the local market I guess
12:19 < kanzure> hah the email from the engineering library is funny
12:19 < kanzure> "The McKinney Engineering Library is hosting two special events on Thursday, September 17 to commemorate IEEE’s 125 Birthday!"
12:19 < kanzure> "Research Bites: 11:00 am- noon"
12:19 -!- kardan_ [n=kardan@p54BE407B.dip.t-dialin.net] has joined #hplusroadmap
12:19 < kanzure> "Get search tips and give product suggestions to IEEE representatives.  "
12:19 < kanzure> "Free Pizza for the 1st 30 attendees. "
12:19 < kanzure> so give the ieee guy a great product idea
12:19 < kanzure> and get free pizza
12:19 < kanzure> got it
12:20 < kanzure> (not that your idea is useful anyway)
12:20 < kanzure> on second thought maybe it's worth at least two slices
12:21 < fenn> "look a BOM!" http://scripts.mit.edu/~emu/fab/wp-content/uploads/2009/07/dsc_8873.jpg
12:21 < fenn> the paper says "kenny and amy's shopbot install kit"
12:22 < kanzure> oh my god that's almost useful
12:22 < kanzure> "here's a picture of the tools you need"
12:22 < kanzure> "and a picture of a list"
12:23  * kanzure asks amy sun
12:24 < kanzure> bah she left
12:30 -!- genehacker [i=genehack@128.62.34.238] has quit [Read error: 145 (Connection timed out)]
12:30 < fenn> i am sort of wondering where the cad files (or whatever passes for CAD in fab-dom) for FabFi are
12:31 < kanzure> btw there's a fab-lab-gurus mailing list
12:32 < fenn> oh. 'download'
12:32 < kanzure> it's smari acting as an interface between some fablab runners he knows and openmanufacturing
12:32 < kanzure> (because apparently "they can't handle it")
12:32 < kanzure> (it, being the truth.)
12:32 < fenn> bleh?
12:33 < fenn> maybe "it" is the signal to noise ratio
12:33 < kanzure> that there are people with the ideas that are presented on om
12:33 < fenn> .png is a cad format?
12:34 < fenn> http://www.fablab.af/fabfi/download/reflectors/xsmall_0_220/1.png
12:34 < kanzure> it is for cutters :(
12:34 < fenn> no, it isn't
12:34 < fenn> i dont understand why they don't use SVG
12:35 < fenn> it was obviously exported to DXF from some other drawing program
12:35 -!- kardan| [n=kardan@p54BE7A5F.dip.t-dialin.net] has quit [Read error: 110 (Connection timed out)]
12:36 < fenn> i dont know if autotracing the png is a good idea or not
12:36 < fenn> god this DXF is terrible
12:38 < kanzure> kanzure: but that's just CAD file format conversion right?
12:38 -!- dira [n=chatzill@86.99.40.183] has joined #hplusroadmap
12:38 < kanzure> kanzure: that's not very useful
12:39 < kanzure> kanzure: how does a PNG capture constraints?
12:39 < kanzure> Amy: each pixel is meaningful, you just scale
12:39 < kanzure> Amy: it depends on the object
12:39 < kanzure> Amy: sometimes only a sepcific thing matters
12:39 < fenn> ask why she doesn't use SVG
12:39 < dira> hey there
12:39 < kanzure> fenn: that was back in march
12:40 < fenn> oh
12:40 < kanzure> she did mention SVG before i did though
12:40 < kanzure> though not why it's not the first suspect
12:40 < kanzure> oh yay she emailed me
12:41 < kanzure> fenn: ok fwd'd it to you
12:41 < fenn> actually it's sort of hard to tell who is doing what, despite them blogging constantly
12:42 < kanzure> "ps - important to have power drill, too"
12:42 < fenn> oh i don't really care about the shopbot install kit in particular
12:43 < fenn> i would like to make a package for FabFi assuming licensing is ok and files exist
12:44 < kanzure> all these photos from afghanistan from fablab.af are fun
12:44 < kanzure> but in the back of my mind i'm laughing, "we make bomb now yes?"
12:44 < fenn> i guess.. i was looking at post-flood destruction
12:44 < kanzure> http://fabfi.fablab.af/
12:45 < kanzure> "we make BOM now yes?"
12:45 < kanzure> hehe
12:45 < fenn> i sort of wonder how the afghani are so clueless in the fab lab when their brothers are out there making IED's
12:45 < kanzure> probably has something to do with "being extreme"
12:46 < fenn> isn't there some sort of reverse tech transfer from the militants? or are they actually all just foreigner
12:46 < kanzure> like, if you don't think your extreme, you thus try less or something?
12:46 < fenn> i dont think it has anything to do with trying
12:46 < fenn> they have these shape charge thingies made from a machined cone of cast copper..
12:47 < fenn> now, copper is rather difficult to machine, especially if you're in the middle of the frickin desert with no tools
12:47 < kanzure> you think IEDs are machined?
12:47 < kanzure> what's improvised about a machined IED?
12:47 < fenn> so i'm looking at these kids with fancy CNC machinery who don't know what a drill bit is and wondering where it all went wrong
12:48 < fenn> uh, i saw some webpage somewhere which i'll probably never find again
12:48 < fenn> sigh. i'm off to have lunch
12:48 < kanzure> anything in particular?
12:48 < fenn> freebirds
12:48 < kanzure> me me me me
12:53 -!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has joined #hplusroadmap
12:55 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap
12:58 -!- dira [n=chatzill@86.99.40.183] has quit [Nick collision from services.]
12:58 -!- dira__ [n=chatzill@86.99.40.183] has joined #hplusroadmap
12:58 -!- dira__ is now known as dira
13:14 -!- superkuh_ is now known as superkuh
14:30 < kanzure> hm so sometimes a wire has points, but sometimes it wont and what you really want is an edge
14:30 < kanzure> but an edge only sometimes has points
15:01 < kanzure> fenn: I'm really really tired of swig telling me that I can't pass something to something else
15:01 < kanzure> it breaks dynamic typing
15:01 < kanzure> any way around this?
15:09 < drazak> kanzure: tito is lulz
15:10 < genehacker> ???
15:38 < kanzure> the wangan midnight ost isn't terrible
15:40 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
16:13 < drazak> fenn: are you ben lipkowitz?
16:14 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap
16:17 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Client Quit]
16:19 < kanzure> oo way: 0 points on all wires
16:19 < kanzure> non-oo way: 36 points on all wires
16:19 < kanzure> however when I let the oo-way consider edges, oo way: 72 points from all of the wires and edges
16:20 < kanzure> (and if I let the oo-way to consider only edges and not wires, it's still 72)
16:20 < kanzure> which one is the wrong one?
16:21 < kanzure> seems to me that all wires are turned into edges in the oop version (even though I'm not doing that)
16:22 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Read error: 110 (Connection timed out)]
16:24 -!- superkuh [n=hukrepus@99.149.170.213] has joined #hplusroadmap
16:49 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Connection timed out]
16:49 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap
16:59 < CIA-32> skdb: kanzure * r 59f7165 /import_tools/surf.py: committing before some big OO changes
16:59 < CIA-32> skdb: kanzure * r 69bc292 /geom/geom.py: worked on Shape, Face, Wire classes in geom module
16:59 < CIA-32> skdb: kanzure * r 2ed1805 / (4 files in 4 dirs): changed surface approximation code over to oo, plus some unit tests
17:01 -!- dira [n=chatzill@86.99.40.183] has left #hplusroadmap []
17:11 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Connection timed out]
17:16 < kanzure> hm
17:16 < kanzure> should i continue as if i only had a point cloud?
17:16 < kanzure> or take advantage of the faces?
17:16 < kanzure> if i assume i only have a point cloud then it will be more generally applicable, although it will likely take longer to figure out
17:17 -!- superkuh [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap
17:19 < drazak> 36 kanzure 
17:19 < kanzure> actually i decided i was ok with 72 and i'll just have to filter out the dupe points
17:24 < kanzure> fenn: ok set requires both __eq__ and __hash__ to be defined for its elements
17:25 < kanzure> why didn't it throw me an exception?
17:25 < drazak> GATA4	GCAGCAGCGAGGAGATGCGT	GGGGAGAGCTTCAGGGCCGA	154	NM_002052.3
17:42  * katsmeow-afk knows only GATTACA
17:54 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap
17:56 < genehacker> wtf
17:57 < genehacker> repair person made my laptop worse
18:02 -!- rook [n=rook@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap
18:03 < katsmeow-afk>  Gadsden Alabama: man uses hospital equipment to beat on and break out 7th floor window, leaps out, dies. The police say it was an accidental death, determining the man did not intend to hit the ground.
18:04 < bkero> what
18:04 < katsmeow-afk> huh?
18:07 -!- rook [n=rook@ip68-226-92-62.ri.ri.cox.net] has left #hplusroadmap []
18:08 -!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap
18:10 < bkero> I don't expect to hit the ground
18:11 < katsmeow-afk> when leaping from a 7th floor window?
18:19 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap
18:20 < wrldpc2> hey rook
18:23 < fenn> maybe he thought he could fly. was it a mental hospital?
18:25 < fenn> it's surprising how often the answer is obvious
18:25 < wrldpc2> lolwut
18:28 -!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has quit ["Leaving"]
18:29 -!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap
18:33 -!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has quit [Read error: 104 (Connection reset by peer)]
18:36 -!- wrldpc2_ [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap
18:36 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 104 (Connection reset by peer)]
18:36 < kanzure> is rook some sort of anonymous root?
18:37 -!- wrldpc2_ is now known as wrldpc2
18:38 < ybit> fenn: you're my hero
18:39 < ybit> at least for a second before strange looks start coming my way
18:39 < ybit> http://web.mit.edu/2.810/www/lecture/Gutowski - Thermo Analysis.pdf
18:39 < ybit> i was thinking about this for the first half of the day today
19:13 < wrldpc2> nah rook is my friend brian, coder from RI
19:36 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Read error: 110 (Connection timed out)]
20:12 -!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap
20:21 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 104 (Connection reset by peer)]
20:22 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap
20:27 < kanzure> genehacker: paul rothemund is presenting at noon tomorrow
20:28 < genehacker> WOAH THANKS
20:31 < kanzure> if you want all of his papers, try this: http://heybryan.org/books/papers/rothemund/
20:36 < katsmeow-afk> "As a research fellow at Caltech, Rothemund has developed a technique to manipulate and fold strands of DNA known as DNA Origami." , so if he wanted, he could make a virus to unfold the mad cow prions and fold them back up properly?
20:37 < katsmeow-afk> praps he shold run a spell checker before he uploads his creds to wikipedia : "The DNA created would be able to devour certain pollutents in the air"
20:39 < kanzure> dont think he put those there
20:39 < kanzure> he's kind of popular these days
20:39 < katsmeow-afk> ok
20:41 < genehacker> and that is why I can't use wikipedia anymore
20:43 < katsmeow-afk> i find, if nothing else, it gives me a narrower error window to refute
21:24 < ybit> katsmeow-afk: :)
21:24 < ybit> anyone used freecad?
21:24 < ybit> occ is not gpl compliant iirc, how can you base software (skdb, freecad) on it and make it gpl
21:27 < ybit> Archimedes, gcad3d,BRL-CAD, varkon from the open cad group
21:27 < ybit> haven't tried 1,2 or 4
21:29 < ybit> http://en.wikipedia.org/wiki/Archimedes_(CAD)
21:29 < ybit> http://www.gcad3d.org/
21:29 < ybit> http://varkon.sourceforge.net/
21:29 < ybit> archimedes looks 2d
21:30 < ybit> i like how in the vokron's documentation, the 2. Why Varkon? section is completely empty
21:32 < ybit> http://gd.tuwien.ac.at/graphics/sced/ Sced is a modelling program that makes use of geometric constraints to edit objects in a virtual world. The scenes created can be exported to a variety of rendering programs, including:
21:32 < ybit> * POVray * Radiance * Rayshade * RenderMan(R) compliant programs, such as the Blue Moon Rendering Tools * VRML browsers 
21:32 < ybit> gcad3d looks the most polished
21:32 < ybit> of the unknown cad programs
21:33 < ybit> http://www.mindmeister.com/28717702/everything-open-and-free
21:33 < ybit> why? please just contribute to skdb already :P
21:34 < ybit> so says someone who hasn't
21:38 < ybit> I'm afraid some day you're going to start forwarding skdb commit messages
21:38 < ybit> directly to the diybio list...
21:38 < ybit> :P
21:43 < kanzure> is that a suggestion fenn?
21:44 -!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has quit []
21:57 < ybit> david nunez is located in austin?
21:58  * ybit is off to bed
21:58 < katsmeow-afk> nite ybit
21:59 < ybit> gn katsmeow-afk 
22:01 -!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: strages, chizu, fenn_adl, CIA-32, boogles
22:02 -!- Netsplit over, joins: fenn_adl, strages, CIA-32, boogles, chizu
22:24 < wrldpc2> name: a good free irc client for linux?
22:25 < QuantumG> XChat
22:25 < kanzure> irssi, bitchx, thousands of others
22:25 < kanzure> emacs?
22:25 < genehacker> I here you can't use irssi in public
22:25 < QuantumG> XChat is actually usable :)
22:26 < genehacker> because people think you're an 3vi1 h4x0r 0h n035!!!!!
22:35 < fenn> kanzure: definitely NOT a suggestion
22:36 < fenn> hence the "snarkily yours"
22:45 -!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit []
23:37 < genehacker> kanzure have you ever turned in a program as a way to "show work" and did you get away with it?
23:38 < genehacker> like for a class assignment