| --- Day changed Thu Apr 23 2009 | ||
| -!- genehacker [n=chatzill@wireless-128-62-98-46.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 00:07 | |
| bkero | nom nom nom | 00:48 |
|---|---|---|
| wrldpc | http://www.jewelinfo4u.com/Diamond_Mines.aspx?Mines | 00:51 |
| fenn | i wonder if this feeling like i'm slowly dying is the normal feeling like i'm dying or due to a bad mango i ate | 01:20 |
| katsmeow-afk | food poisoning can definitely make you feel death | 01:27 |
| ybit | kanzure, why not instead of creating a mailing list, just setup an rss feed of new papers you add to the collection? | 01:42 |
| ybit | also of note: lxml | 01:44 |
| ybit | http://www.ibm.com/developerworks/xml/library/x-hiperfparse/ | 01:44 |
| ybit | ..or maybe just setup a page to view the git log for biotech toolkit? | 01:49 |
| ybit | i guess the mailing list could work since it allows for feedback | 01:50 |
| -!- any22156021 [n=someone@75-120-216-168.dyn.centurytel.net] has joined #hplusroadmap | 02:00 | |
| -!- katsmeow-afk [n=someone@75-120-45-59.dyn.centurytel.net] has quit [Read error: 60 (Operation timed out)] | 02:04 | |
| -!- duzt is now known as duzt|s133p | 02:17 | |
| -!- any15162617 [n=someone@75-120-47-194.dyn.centurytel.net] has joined #hplusroadmap | 02:21 | |
| -!- any22156021 [n=someone@75-120-216-168.dyn.centurytel.net] has quit [Read error: 60 (Operation timed out)] | 02:27 | |
| -!- elias` [n=me@unaffiliated/elias/x-342423] has quit [Read error: 145 (Connection timed out)] | 07:31 | |
| -!- jm [n=jm@p57B9CC17.dip.t-dialin.net] has joined #hplusroadmap | 07:31 | |
| -!- elias` [n=me@cs78208074.pp.htv.fi] has joined #hplusroadmap | 07:39 | |
| kanzure | "standard disclaimer: welcome to bryan's brain. he probably doesn't know it, but he's already beginning to neglect you. if you want to keep up, you will need to yell at him extensively for the IRC channels, RSS feeds, emails, etc., to keep up with him." | 07:56 |
| kanzure | :/ | 07:56 |
| kanzure | why isn't there an automatic feedback mechanism built into RSS | 07:57 |
| * kanzure hunts down aaron swartz | 07:57 | |
| faceface | kanzure: you heard of DAS? | 07:58 |
| faceface | Distributed annotation system | 07:58 |
| -!- faceface is now known as pingface | 07:59 | |
| kanzure | ok, I've added RSS back to heybryan.org | 08:06 |
| kanzure | enjoy. | 08:06 |
| pingface | there is also a protocol called 'das writeback' for commenting on a das annotation | 08:08 |
| UtopiahGHML | pingface: probably a bit different but ShiftSpace http://www.shiftspace.org/ is interesting | 08:10 |
| -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has quit [] | 08:18 | |
| -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has joined #hplusroadmap | 08:19 | |
| pingface | UtopiahGHML: right | 08:22 |
| -!- pingface is now known as faceface | 08:26 | |
| -!- kanzure- [n=bryan@66.112.232.230] has quit ["leaving"] | 09:03 | |
| -!- duzt|s133p is now known as duzt | 10:52 | |
| kanzure | haha, I like how sonoluminescence has like 1% efficiency of mechanical energy into light | 11:11 |
| -!- jm|space [n=jm@p57B9C821.dip.t-dialin.net] has joined #hplusroadmap | 11:11 | |
| -!- kanzure- [n=bryan@66.112.232.230] has joined #hplusroadmap | 11:12 | |
| -!- jm [n=jm@p57B9CC17.dip.t-dialin.net] has quit [Read error: 110 (Connection timed out)] | 11:28 | |
| -!- duzt is now known as duzt|shower | 11:36 | |
| -!- wrldpc [n=worldpea@pool-173-48-214-204.bstnma.fios.verizon.net] has quit [] | 11:39 | |
| -!- jelleferinga [n=jellefer@49.166.101-84.rev.gaoland.net] has joined #hplusroadmap | 11:43 | |
| -!- jelleferinga [n=jellefer@49.166.101-84.rev.gaoland.net] has quit [] | 11:44 | |
| -!- duzt|shower is now known as duzt | 11:51 | |
| -!- any15162617 is now known as katsmeow-afk | 11:51 | |
| kanzure | http://heybryan.org/books/papers/%20In%20situ%20DNA%20synthesis%20on%20glass%20substrate%20for%20microarray%20fabrication%20using%20self-focusing%20acoustic%20transducer.pdf | 12:40 |
| kanzure | DNA synthesis microfluidic device using piezos | 12:40 |
| kanzure | using only four piezos | 12:42 |
| kanzure | hrm | 12:42 |
| kanzure | heh they mechanically rotate the entire device around so that they can manually do the washing / deblocking steps for phosphoramidite synthesis | 12:46 |
| kanzure | droplets are continuously ejected for a minute each? hrm. | 12:48 |
| xp_prg | kanzure I so enjoy microfluidics, I can't wait to see something practical to use for bio tech experiments at the diybio level | 12:52 |
| kanzure | I think the first thing that might come is DNA synthesis, or possibly PCR | 12:52 |
| kanzure | I'm looking at this design and it doesn't make much sense | 12:53 |
| kanzure | the idea is to use resevoires of nucleotides and to them cause droplets to move out of them and into a synthesis chamber | 12:53 |
| kanzure | but then why are all of these microchannels intersecting each other. hrm. | 12:53 |
| xp_prg | do you feel there are any practical microfluidic type usage at the diybio level yet? | 12:54 |
| kanzure | oh. it's for producing *only* 3x3 DNA probes haha | 12:54 |
| kanzure | yes, of course | 12:54 |
| kanzure | PCR, dna synthesis, dna sequencing, etc. etc. | 12:54 |
| xp_prg | it would be amazing to know those in detail, I would begin to use them for diybio-sf | 12:54 |
| kanzure | http://heybryan.org/books/papers/microfluidics/ | 12:55 |
| kanzure | start reading :) | 12:55 |
| xp_prg | ok | 12:55 |
| kanzure | here's an easy design for PCR: http://heybryan.org/books/papers/microfluidics/gkm389%20Miniaturized%20PCR%20chips%20for%20nucleic%20acid%20amplification%20and%20analysislatest%20advances%20and%20future%20trends.pdf | 12:56 |
| kanzure | it's a spiral, and at the four corners of the plate you put heating/cooling elements | 12:56 |
| kanzure | hrm | 13:27 |
| kanzure | "to have an idea of who you are.. ask me for a microlfuidics device that would useful for you adn i will make itwork and send it to you for free (and so you can see what i do).. i will only do the microfluidics working device (no electrical connections or computer interface). you can use any designing software that you wish..ok?" | 13:27 |
| kanzure | wonder what would be the best way to recover high density oligonucleotide arrays synthesized on a microfluidics chip | 13:52 |
| kanzure | especially if it's not an open-air system | 13:52 |
| -!- wrldpc [n=worldpea@c-76-19-107-75.hsd1.ma.comcast.net] has joined #hplusroadmap | 13:53 | |
| -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap | 13:56 | |
| genehacker | can you get him to tell us the smalllest feature size we can get? | 13:57 |
| genehacker | kanzure | 13:57 |
| genehacker | I'd like to know the smallest feature size that diybio guy will give us | 13:57 |
| kanzure | okay | 13:57 |
| kanzure | 20 microns | 13:57 |
| genehacker | that sounds pretty damn big | 13:58 |
| genehacker | I have preexisting designs for a logic gates | 13:58 |
| genehacker | I found a patent for a fluidic credit card reader and a couple fluidic registers | 13:59 |
| kanzure | you don't have any designs already on your hard drive for anything relatively complete? | 13:59 |
| genehacker | we can copy the circuit diagram and downsize it | 13:59 |
| genehacker | the closest thing I have to relatively complete is a fluidic amplifier silhouete | 14:00 |
| kanzure | what does it amplify? | 14:00 |
| genehacker | sound | 14:00 |
| kanzure | okay | 14:01 |
| kanzure | sounds good to me | 14:01 |
| genehacker | http://www.dself.dsl.pipex.com/MUSEUM/COMMS/fluidicgramophone/fluidgram.htm | 14:01 |
| genehacker | it's in gif | 14:01 |
| -!- wrldpc [n=worldpea@c-76-19-107-75.hsd1.ma.comcast.net] has quit [] | 14:02 | |
| genehacker | hey you said you designed microcontroller right? | 14:03 |
| kanzure | that's true. | 14:05 |
| genehacker | this one has dimensions | 14:05 |
| kanzure | what? | 14:05 |
| genehacker | http://ieeexplore.ieee.org/stamp/stamp.jsp?tp=&arnumber=494010 | 14:05 |
| kanzure | blah.. | 14:05 |
| genehacker | here's an actual design | 14:05 |
| kanzure | I just sent the fluidic amplifier design | 14:05 |
| genehacker | cool | 14:06 |
| genehacker | so how does your microcontroller work? | 14:06 |
| kanzure | one thing I designed a long time ago was a simple 4 bit microprocessor | 14:06 |
| kanzure | so it had some basic arithmetic logic units for add, subtract, multiply, etc., | 14:07 |
| kanzure | and then some logic elements to recognize instructions, read from the instruction buffer memory, etc. | 14:07 |
| kanzure | very very basic | 14:07 |
| genehacker | how many logic gates did it use? | 14:08 |
| kanzure | I don't know if I ever generated the final schematics, I was mostly just programming in Verilog or something | 14:10 |
| xp_prg | kanzure I suggested the simple pcr on diybio and they are open but feel it could be too difficult can you help explain why it is easy/possible? | 14:10 |
| xp_prg | with microfluidics | 14:10 |
| kanzure | why do they feel it would be too difficult? | 14:10 |
| genehacker | what does programming in verilog look like? | 14:10 |
| xp_prg | cons: we have to figure out how to design the fluidic circuit, the heater/cooler, what materials to use, how to clean between samples, how to actually build it, and finally, how to integrate a visualiser so we can still do qPCR | 14:10 |
| xp_prg | I am down for doing this, but is it really going to be possible with our means? | 14:10 |
| genehacker | we're talking about making a microfluidic graphing calculator | 14:11 |
| genehacker | someone's offering to make any microfluidic device for us for free | 14:11 |
| xp_prg | wow cool! | 14:12 |
| xp_prg | who is this person? | 14:12 |
| genehacker | someone from diybio | 14:12 |
| xp_prg | well who? | 14:12 |
| xp_prg | where are they located? | 14:12 |
| genehacker | the only caveat is that we can't use electrical devices | 14:12 |
| genehacker | no idea who | 14:14 |
| genehacker | Nanoscience technology is their post name | 14:14 |
| xp_prg | oh I did see that post | 14:14 |
| xp_prg | kanzure please respond to the thermocycler diybio thread | 14:16 |
| kanzure | xp_prg: with what | 14:16 |
| xp_prg | with an argument addressing the concern with a microfluidic pcr approach | 14:16 |
| kanzure | at this point I think it would be better to go with the more traditional design because people already know how that works | 14:17 |
| kanzure | I'm more interested in working on a DNA synthesizer or something | 14:17 |
| kanzure | which might actually be simpler | 14:17 |
| genehacker | damn good point | 14:17 |
| kanzure | genehacker: so I think I can design a DNA synthesizer | 14:17 |
| kanzure | but | 14:17 |
| kanzure | what I don't know how to do is get it so that all of the samples are easily accessible | 14:18 |
| kanzure | consider for instance if there was a 2-plate sandwich DNA synthesizer | 14:18 |
| kanzure | made out of microfluidic channels and such | 14:18 |
| kanzure | how would samples be recovered | 14:18 |
| kanzure | one idea is to use a straw with emulsions so that you literally drain the DNA into the straw, and then cap it with oil or something on either side | 14:20 |
| kanzure | and then you number the slots in the straw | 14:20 |
| kanzure | and then you poke a hole when you want to drain it or something :p | 14:20 |
| genehacker | cut copy paste | 14:20 |
| kanzure | ? | 14:20 |
| genehacker | IE integrate a PCR step | 14:20 |
| kanzure | cut what? | 14:20 |
| kanzure | so wait | 14:20 |
| kanzure | what about for synthesizing multiple strands at once | 14:20 |
| kanzure | not just synthesizing the same strand a million times | 14:21 |
| kanzure | I guess doing the same sequence a million times would be fine | 14:21 |
| kanzure | then you could mix it together | 14:21 |
| kanzure | but where do you send it | 14:21 |
| genehacker | just copy the final combined product over and over again | 14:21 |
| genehacker | http://www.youtube.com/watch?v=JvDZh8hmR84&feature=related | 14:21 |
| kanzure | where do you put it? | 14:21 |
| genehacker | sharpie microfluidic based DNA sequencer | 14:21 |
| genehacker | er... droplet based | 14:21 |
| genehacker | well I have to go, lets figure out some way we can design microfluidic circuits | 14:22 |
| genehacker | something like verilog | 14:23 |
| kanzure | sure | 14:23 |
| kanzure | but I still need to know where to *put* the products | 14:23 |
| kanzure | genehacker: if you work for campbell over the summer we could get that verilog thingy working actually | 14:26 |
| kanzure | ok guess we could do a drill-through screw-on-cap container drain dealy | 14:28 |
| -!- wrldpc_ [n=worldpea@pool-72-85-179-84.bstnma.east.verizon.net] has joined #hplusroadmap | 14:38 | |
| -!- wrldpc_ [n=worldpea@pool-72-85-179-84.bstnma.east.verizon.net] has quit [] | 14:48 | |
| -!- splicer [n=patrik@h10n1c1o261.bredband.skanova.com] has joined #hplusroadmap | 14:57 | |
| -!- wrldpc [n=worldpea@c-66-30-12-190.hsd1.ma.comcast.net] has joined #hplusroadmap | 15:00 | |
| kanzure | hrm I think I've designed a non-reprogrammable (or non-programmable) DNA synthesizer | 15:02 |
| kanzure | it only synthesizes the specific sequence it was made to synthesize | 15:02 |
| -!- wrldpc [n=worldpea@c-66-30-12-190.hsd1.ma.comcast.net] has quit [Client Quit] | 15:04 | |
| kanzure | so, I need to figure out how to properly do scheduling of droplet movements | 15:41 |
| kanzure | just do rapid switching between interrupts? erm. so there's something like 500 elements that move the droplets | 15:42 |
| kanzure | each one can be addressed individually | 15:42 |
| kanzure | when one is switched on (adjacent to the last one), the droplet moves towards the one that is switched on | 15:42 |
| kanzure | I mean, will I be shot for not writing a proper task manager? | 15:43 |
| fenn | i've got quite a dependency tree built up before i can get a driver's license (before mine expires next week) | 16:02 |
| kanzure | eh? | 16:02 |
| kanzure | things to do? | 16:02 |
| fenn | things i didnt know i had to do | 16:02 |
| kanzure | ok, now stand on your head | 16:03 |
| kanzure | or else | 16:03 |
| -!- duzt [n=duzt@dsl093-216-054.aus1.dsl.speakeasy.net] has quit [] | 16:03 | |
| fenn | i don't think it's all going to happen | 16:03 |
| kanzure | "Bryan, I realized I'm not quite clear on the title of your role at DIYbio. Co-founder, contributor, guru?" | 16:04 |
| fenn | this was the crayon sketch thingy i was trying to remember http://www.dgp.toronto.edu/~shbae/ilovesketch.htm | 16:09 |
| kanzure | "enormous prick" | 16:25 |
| kanzure | aw :( | 16:25 |
| fenn | is that a compliment? | 16:28 |
| kanzure | I don't think so | 16:28 |
| kanzure | they didn't say that | 16:29 |
| kanzure | I'm just expecting something un-nice | 16:29 |
| fenn | i'm getting lots of spam email lately, mostly penis enlargement and related stuffs | 16:38 |
| kanzure | http://bioweathermap.org/ released | 16:50 |
| kanzure | ok, some diagrams of schemes for DNA synthesis with droplets | 17:04 |
| kanzure | http://heybryan.org/~bbishop/docs/DNAsynthesizer/ | 17:04 |
| kanzure | fear my mad diagramming skills. | 17:28 |
| fenn | i think i'm going to give up on life and go back to my parent's house | 17:37 |
| kanzure- | depressed? | 17:37 |
| fenn | i don't know.. | 17:38 |
| fenn | yesterday i wanted to go to the shop and work on stuff but i had to lay down.. for like 8 hours | 17:39 |
| kanzure- | weren't you feeling sick? | 17:39 |
| fenn | it was just sort of more intense version of the usual | 17:40 |
| fenn | anyway, i guess i don't have whatever it takes to keep my shit together | 17:40 |
| kanzure- | somebody yell at you? | 17:40 |
| fenn | there's no way i'm going to get all this stuff to fix my car | 17:40 |
| kanzure- | you mean, a license? | 17:41 |
| fenn | i have to buy a new tail light and brake cylinder, install them, insurance | 17:41 |
| fenn | need ^^ and social security card to get a license, my license expires on may 2nd | 17:42 |
| fenn | oh i also have to register the title and pay a 'new resident tax' which is $90 | 17:42 |
| kanzure- | resident tax?? | 17:42 |
| fenn | and steve doesn't have money to pay me for another couple weeks | 17:42 |
| fenn | so anyway, without a car i'm just a drag on les | 17:43 |
| fenn | that's the logic at least | 17:43 |
| fenn | i've been struggling to keep up for about a year though | 17:43 |
| -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 17:43 | |
| kanzure- | KEEP WHAT UP? | 17:43 |
| kanzure- | erm, caps lock | 17:43 |
| kanzure- | so what happened to the idea of selling the car and getting something else? | 17:44 |
| fenn | was that an idea i had? | 17:44 |
| kanzure- | when you were thinking of coming down | 17:44 |
| fenn | there was some guy who left a note on the door a couple weeks ago expressing interest in buying the car | 17:45 |
| kanzure- | did you have a sign on it? | 17:45 |
| fenn | no | 17:45 |
| kanzure- | is that usual behavior of people? | 17:45 |
| fenn | but i really like that car and don't expect to find another | 17:45 |
| kanzure- | to put notes on things expressing interest in buying it? | 17:45 |
| fenn | i guess CRX's are popular with mexicans | 17:45 |
| fenn | it's been sitting in les' driveway and i don't go places very often, so it's possible he thought it wasn't being driven at all | 17:46 |
| kanzure- | is les paying you anything? | 17:47 |
| fenn | i did some metalworking stuff for a couple days and he mumbled something about 'maybe i'll give you a couple months rent at the shop' | 17:47 |
| fenn | but i haven't brought it up | 17:47 |
| kanzure- | other than that though? | 17:48 |
| fenn | no | 17:48 |
| fenn | he is letting me stay in his house rent free though | 17:48 |
| kanzure- | worst case scenario you can get a job with my mom but the gas will kill you | 17:48 |
| kanzure- | she's out in Kyle, Tx | 17:49 |
| kanzure- | well, her shop is actually in Lockhart, Tx | 17:50 |
| kanzure- | alternatively you could make some rounds with me here at the labs if you want, | 17:51 |
| kanzure- | there's a way to make this work. | 17:51 |
| fenn | do you really think they'd hire me at one of the labs? | 17:51 |
| fenn | also there's more to this than just money | 17:52 |
| kanzure- | yes | 17:52 |
| * fenn goes to fill out a return to manufacturer authorization form for his body | 17:54 | |
| kanzure- | if the not-getting-your-shit-together is just a matter of money, then that's solved | 17:54 |
| fenn | one hypothesis for why i don't have a good steady job already is that i'm "addicted to the internet" | 17:55 |
| kanzure- | according to who? | 17:55 |
| fenn | but i don't think this is correct because i did an experiment | 17:55 |
| kanzure- | oh? | 17:55 |
| fenn | according to me, based on sensationalist media about the dangers of technology | 17:56 |
| kanzure- | is it possible that you just haven't found an interesting job | 17:56 |
| fenn | about a year ago (?) i moved into my friend rob's house.. rob lives way out in the country with dialup.. basically impossible to use the net, so i didnt | 17:56 |
| kanzure- | er, what did you do ? | 17:56 |
| fenn | absolutely nothing | 17:57 |
| kanzure- | sounds boring | 17:57 |
| fenn | i stared at the ceiling | 17:57 |
| fenn | and my sleep phase was still off | 17:57 |
| fenn | oh, and i worked on my car because it needed a new water pump | 17:57 |
| kanzure- | so again, is it possible that you just haven't found an interesting job [that pays] | 17:58 |
| fenn | that was when i realized i was basically stuck there without my car, and i'd have to drive anywhere to do anything or see any people (rob travels a lot), so i moved back into the old house | 17:58 |
| fenn | even though i have a pile of projects i haven't gotten around to doing them | 18:00 |
| kanzure- | do you have the resources to make them happen? | 18:00 |
| fenn | so it'd be hard to find a more interesting job | 18:00 |
| fenn | i have all the pieces necessary, yes | 18:01 |
| kanzure- | wait, really? | 18:01 |
| fenn | well, sort of.. i still need to con les out of his laser printer so i can etch circuit boards, but that doesn't stop me from doing the layout or whatever | 18:01 |
| kanzure- | for what? | 18:01 |
| fenn | the cnc motor drivers | 18:02 |
| kanzure- | oh. pcb boards for them. | 18:02 |
| fenn | which i've been talking about since 2005 | 18:02 |
| kanzure- | sometimes thinking is hard for me. it's like squeezing out a thought or something. | 18:02 |
| kanzure- | tools sometimes make it easier or something | 18:02 |
| kanzure- | but it's always even more easy if somebody threw up a script to do it or something | 18:02 |
| fenn | i can write my own script | 18:02 |
| kanzure- | well, script as in .. erm .. | 18:03 |
| kanzure- | not for the shell. | 18:03 |
| kanzure- | but for doing things | 18:03 |
| fenn | todo list, with bullet points | 18:03 |
| kanzure- | just because it's on a list doesn't mean you'll get it done | 18:03 |
| kanzure- | or that I'll get it done for that matter | 18:03 |
| fenn | exactly | 18:03 |
| kanzure- | so here's a theory | 18:03 |
| kanzure- | with a limited set of bullets on a page | 18:03 |
| fenn | i can make a detailed list but i won't do it | 18:03 |
| kanzure- | some percentage of them will get done by at least one of us | 18:03 |
| kanzure- | is it possible to make it so that we both do the other things that we won't do | 18:04 |
| kanzure- | heh' | 18:04 |
| kanzure- | or would that just make some sort of tri-combination of terribleness | 18:04 |
| fenn | yes it's possible but there's interpretation issues | 18:04 |
| fenn | much easier to do something you understand than to explain it to someone else | 18:04 |
| kanzure- | well, if you understand it, then you should be able to explain it (supposedly) | 18:04 |
| kanzure- | that's sometimes where I get worked up. recursing through the tree of explanations | 18:05 |
| kanzure- | or bush of explanations | 18:05 |
| kanzure- | gee, you know what would be useful here .. | 18:05 |
| fenn | skdb wouldn't be useful here | 18:05 |
| kanzure- | why's that? | 18:06 |
| fenn | except for maybe letting me know a month ago i had to do all this crap to get my driver's license | 18:06 |
| kanzure- | oh. btw. there's a renew-your-license-over-the-web dealy here in texas | 18:06 |
| fenn | not for out of state license | 18:07 |
| fenn | did you know they take your thumbprints? | 18:07 |
| kanzure- | yes | 18:08 |
| kanzure- | so when I turned 18, I started ranting around asking for a 'guidebook to stuff that the state needs to tell you now that you're 18" | 18:13 |
| kanzure- | but nobody keeps that sort of documentation | 18:14 |
| kanzure- | anyway, keep me in the loop. I think you're more useful here than there. | 18:15 |
| fenn | well my idea was to go there and have them spend lots of money for me to go to various doctors, then i'll be fixed, and capable of actually doing stuff | 18:24 |
| kanzure- | do you have healthcare insurance? | 18:25 |
| fenn | i don't actually have much faith in doctors but it might be something simple | 18:25 |
| fenn | no, i don't have health insurance | 18:25 |
| kanzure- | ah, well then. | 18:25 |
| fenn | dad was supposed to be setting that up but i guess he never finished | 18:25 |
| kanzure- | do you have to go there for them to get you health care? | 18:25 |
| kanzure- | you should probably poke him about that before you physically move | 18:25 |
| kanzure- | and if you want you can always try what they're forcing down my throat these days. it seems to do, something | 18:26 |
| fenn | what's that, adderall? | 18:26 |
| kanzure- | yes. 5 mg, 10 mg, and 30 mg. and I'm also on prozac now, but I don't know what it's doing and wouldn't recommend it. | 18:27 |
| fenn | why are you on prozac? | 18:27 |
| kanzure- | the doctor thinks I'm depressed | 18:27 |
| kanzure- | and honestly it's because mom says dad thought I was depressed | 18:27 |
| kanzure- | (she said that to the doctor) | 18:27 |
| fenn | der... woah | 18:28 |
| kanzure- | yeah .. | 18:28 |
| kanzure- | he also thinks I have OCD, but that's not as bad as thinking I'm depressed | 18:28 |
| kanzure- | he's actually a bright guy. just don't agree about the depression stuff. | 18:28 |
| kanzure- | besides, it's one of those medications that takes a while to build up into the system | 18:29 |
| kanzure- | adderall will be working in 15 to 30 minutes. | 18:29 |
| kanzure- | um. so any ideas on making an oligonucleotide array but out of 2D channels for microfluidics operations? | 18:47 |
| kanzure- | without intersecting lines | 18:47 |
| kanzure- | I guess with electrowetting you don't need to have channel walls | 18:48 |
| -!- DrTread [n=irchon@71.145.152.176] has joined #hplusroadmap | 18:58 | |
| -!- xp_prg [n=xp_prg3@99.2.31.217] has quit ["This computer has gone to sleep"] | 18:59 | |
| DrTread | FYI I'm showing off the MakerBot kit @ the robot group tonite. | 18:59 |
| fenn | where's that? | 19:00 |
| DrTread | south mopac | 19:00 |
| kanzure- | wah. | 19:00 |
| kanzure- | are you going to come and get me? | 19:00 |
| DrTread | Heritage at Gaines Ranch retirement home | 19:01 |
| fenn | ah good, i think i'll go | 19:01 |
| DrTread | yes. for reals? | 19:01 |
| kanzure- | I would appreciate a ride :) | 19:01 |
| DrTread | where u @? | 19:01 |
| kanzure- | 24th and Guadalupe. | 19:01 |
| kanzure- | http://maps.google.com/maps?f=q&source=s_q&hl=en&geocode=&q=2323+San+Antonio+St,+Austin,+TX+78705&sll=37.0625,-95.677068&sspn=14.70541,65.302734&ie=UTF8&ll=30.297425,-97.742443&spn=0.007781,0.031886&t=h&z=15&iwloc=r0 | 19:02 |
| kanzure- | aren't you north of austin? | 19:02 |
| DrTread | ok. I'm leaving here in 10 min | 19:02 |
| kanzure- | do you have my number? | 19:02 |
| DrTread | east south east | 19:02 |
| kanzure- | oh | 19:02 |
| DrTread | I think so. | 19:02 |
| kanzure- | if I'm out of your way then don't bother | 19:02 |
| kanzure- | thought you were north | 19:03 |
| DrTread | but I want to get you! *pouts* | 19:03 |
| kanzure- | okay | 19:03 |
| kanzure- | fenn: will you be there? | 19:04 |
| fenn | yep | 19:05 |
| -!- DrTread [n=irchon@71.145.152.176] has quit [] | 19:09 | |
| -!- DrTread [n=irchon@71.145.152.176] has joined #hplusroadmap | 19:11 | |
| kanzure- | soo it looks like we just need algorithms for moving droplets over surfaces in some optimal way | 19:11 |
| kanzure- | and then some way to make more droplets from a resevoire | 19:11 |
| DrTread | kanzure on my iPhone now. plz resend coordinates. | 19:11 |
| kanzure- | pyrosequencing | 19:11 |
| kanzure- | erm | 19:11 |
| kanzure- | http://maps.google.com/maps?f=q&source=s_q&hl=en&geocode=&q=2323+San+Antonio+St,+Austin,+TX+78705&sll=37.0625,-95.677068&sspn=14.70541,65.302734&ie=UTF8&ll=30.297425,-97.742443&spn=0.007781,0.031886&t=h&z=15&iwloc=r0 | 19:12 |
| -!- DrTread_ [n=irchon@cpe-70-112-223-97.austin.res.rr.com] has joined #hplusroadmap | 19:13 | |
| DrTread_ | crap. as soon as I walk out of wifi range, the map disappears. email coordinates, plz | 19:14 |
| kanzure- | um, one moment | 19:14 |
| kanzure- | basically search for "The Castilian" | 19:14 |
| kanzure- | it's at 24th and San Antonio or 24th and Guadalupe (the main intersection) | 19:15 |
| * fenn departs | 19:17 | |
| kanzure- | http://cgi3.ebay.com/ws/eBayISAPI.dll?ViewUserPage&userid=dna_for_charity | 19:17 |
| kanzure- | bidding starts at $68k for whole genome sequencing by Knome | 19:18 |
| kanzure- | includes private dinner with Church | 19:18 |
| kanzure- | should I take out a loan and bid $100k? | 19:18 |
| -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap | 19:20 | |
| -!- DrTread__ [n=irchon@166.133.78.80] has quit [Remote closed the connection] | 19:29 | |
| -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap | 19:29 | |
| -!- DrTread [n=irchon@71.145.152.176] has quit [Read error: 110 (Connection timed out)] | 19:31 | |
| -!- DrTread_ [n=irchon@cpe-70-112-223-97.austin.res.rr.com] has quit [Read error: 110 (Connection timed out)] | 19:34 | |
| bkero | Sure | 19:34 |
| kanzure | ? | 19:36 |
| kanzure | will you give me the $100k? | 19:36 |
| -!- DrTread__ [n=irchon@166.133.78.80] has quit [] | 19:37 | |
| -!- DrTread__ [n=irchon@166.133.78.80] has joined #hplusroadmap | 19:37 | |
| -!- DrTread__ [n=irchon@166.133.78.80] has quit [Remote closed the connection] | 19:37 | |
| -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap | 19:37 | |
| kanzure | DrTread__: have you left? | 19:37 |
| kanzure | genehacker: want to see a makerbot tonight? | 19:37 |
| -!- DrTread [n=irchon@166.133.78.80] has joined #hplusroadmap | 19:37 | |
| kanzure | DrTread: have you left? | 19:37 |
| DrTread | I'm in Austin now | 19:38 |
| DrTread | eta 7:51 | 19:38 |
| genehacker | MAKERBOT WHERE? | 19:42 |
| genehacker | AUUUUAUAGUCUACUACUCAUGAAGGUGCUAUGGAA | 19:42 |
| genehacker | translate to protein | 19:42 |
| kanzure | genehacker: where are you? | 19:42 |
| genehacker | in my dorm | 19:43 |
| genehacker | where are you? | 19:43 |
| kanzure | if you come to my dorm maybe you can hitch a ride with me | 19:43 |
| kanzure | within the next five minutes | 19:43 |
| genehacker | how long will it take? | 19:43 |
| kanzure | possibly until 11 | 19:43 |
| genehacker | where are we going? | 19:43 |
| kanzure | I'm going to the robot group meeting | 19:43 |
| kanzure | DrTread is picking me up | 19:43 |
| genehacker | hmmmm... | 19:43 |
| -!- DrTread [n=irchon@166.133.78.80] has quit [] | 19:43 | |
| genehacker | choices choices | 19:43 |
| kanzure | at least stop by and say hello | 19:43 |
| genehacker | do you think they'd let me work on stuff there? | 19:43 |
| genehacker | like my homework | 19:44 |
| genehacker | ? | 19:44 |
| genehacker | ah screw it | 19:44 |
| genehacker | I'm going | 19:44 |
| kanzure | yeah sure | 19:44 |
| genehacker | I don't have that much | 19:44 |
| genehacker | AUUUUAUAGUCUACUACUCAUGAAGGUGCUAUGGAA | 19:44 |
| -!- DrTread [n=irchon@166.133.18.32] has joined #hplusroadmap | 19:52 | |
| -!- DrTread [n=irchon@166.133.18.32] has quit [Remote closed the connection] | 19:52 | |
| -!- truename [n=truename@c-76-125-146-206.hsd1.pa.comcast.net] has quit [Read error: 110 (Connection timed out)] | 19:58 | |
| -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 20:05 | |
| katsmeow-afk | titanium nanotubes contaminated with potassium split water to hydrogen with 1/3 the electricity as uncontaminated : http://www.eurekalert.org/pub_releases/2009-04/nios-doa042309.php | 21:06 |
| katsmeow-afk | how to punch nanoholes in cell membranes : The paper is called "Amyloid-beta-induced ion flux in artificial lipid bilayers and neuronal cells: Resolving a controversy." | 21:17 |
| ybit | w00t rss feeds :P | 21:27 |
| ybit | http://www.darpa.mil/dso/programs.htm#m | 23:41 |
| ybit | "Mathematical Time Reversal " | 23:41 |
| kanzure | well now. | 23:49 |
| * kanzure gawks at tool list | 23:49 | |
| -!- genehacker [n=chatzill@wireless-128-62-93-17.public.utexas.edu] has joined #hplusroadmap | 23:51 | |
| kanzure | genehacker: hey | 23:52 |
| kanzure | the interview will be published Monday | 23:52 |
| genehacker | what will? | 23:52 |
| kanzure | the interview with singularity hub about diybio | 23:52 |
| genehacker | hmmm | 23:53 |
Generated by irclog2html.py 2.15.0.dev0 by Marius Gedminas - find it at mg.pov.lt!