| --- Log opened Mon Dec 29 00:00:06 2014 | ||
| -!- FAMAS2 [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 00:01 | |
| -!- strangewarp_ [~strangewa@c-76-25-206-3.hsd1.co.comcast.net] has joined ##hplusroadmap | 00:01 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Ping timeout: 252 seconds] | 00:03 | |
| -!- strangewarp [~strangewa@c-76-25-206-3.hsd1.co.comcast.net] has quit [Ping timeout: 252 seconds] | 00:03 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 244 seconds] | 00:07 | |
| fenn | Great fleas have little fleas upon their backs to bite 'em, | 00:08 |
|---|---|---|
| fenn | And little fleas have lesser fleas, and so ad infinitum. | 00:08 |
| fenn | And the great fleas themselves, in turn, have greater fleas to go on; | 00:08 |
| fenn | While these again have greater still, and greater still, and so on. | 00:08 |
| -!- agentsmith2 [~lolzilla@cpe-24-165-87-208.san.res.rr.com] has quit [] | 00:14 | |
| -!- agentsmith2 [~lolzilla@cpe-24-165-87-208.san.res.rr.com] has joined ##hplusroadmap | 00:14 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 00:16 | |
| -!- augur_ [~augur@c-71-57-177-235.hsd1.fl.comcast.net] has joined ##hplusroadmap | 00:17 | |
| -!- FAMAS2 [~FAMAS@182.48.84.40] has quit [Read error: Connection reset by peer] | 00:18 | |
| -!- augur [~augur@c-71-57-177-235.hsd1.fl.comcast.net] has quit [Ping timeout: 252 seconds] | 00:19 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 00:19 | |
| fenn | a nice 20MP camera http://sentryscope.com/imagelibrary.html | 00:32 |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Read error: Connection reset by peer] | 00:32 | |
| fenn | where's waldo | 00:35 |
| nmz787 | fenn https://raw.githubusercontent.com/nmz787/microfluidic-cad/master/implicitCAD/output/tobacco_mesophyll_protoplast_fusion_device__3D.png | 00:39 |
| nmz787 | fenn https://raw.githubusercontent.com/nmz787/microfluidic-cad/master/implicitCAD/output/tobacco_mesophyll_protoplast_fusion_device.png | 00:39 |
| nmz787 | err https://raw.githubusercontent.com/nmz787/microfluidic-cad/master/implicitCAD/output/tobacco_mesophyll_protoplast_fusion_device.jpg | 00:40 |
| fenn | some of the posts on the right side have fused together | 00:48 |
| fenn | and other posts are missing | 00:48 |
| nmz787 | yeah, the SVG that I converted to that JPG used the same "$quality=400" but the STL came out worse | 01:03 |
| -!- Viper168 [~Viper@unaffiliated/viper168] has quit [Ping timeout: 245 seconds] | 01:04 | |
| -!- Viper168 [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 01:11 | |
| -!- delinquentme [~dingo@74.61.157.78] has joined ##hplusroadmap | 01:13 | |
| -!- ebowden [~ebowden@CPE-60-231-182-230.lns4.dav.bigpond.net.au] has joined ##hplusroadmap | 01:19 | |
| fenn | The SentryScope camera contains a linescan image sensor and a precisely controlled scanning mirror. At each instant of time the sensor records only a narrow vertical line in the monitored area. The motion of the scanning mirror causes this vertical line to sweep across the area from left-to-right in about one second. | 01:26 |
| fenn | Up to 10,240 vertical lines are recorded during the scan, forming the full image. | 01:26 |
| nmz787 | fenn: do you know anything about nurbs surfaces? | 01:30 |
| fenn | i know they are quintic polynomials | 01:31 |
| nmz787 | this is something I thought would make a parabolic channel, but fails to do anything http://paste.pound-python.org/show/8u5tbHkBaLJbdXKfyOLU/ | 01:31 |
| nmz787 | while this code http://paste.pound-python.org/show/auESqxrEHgdMiHU7S6lH/ | 01:32 |
| nmz787 | produces http://imgur.com/MNTRGmL | 01:33 |
| nmz787 | another view http://imgur.com/pyzVJyz | 01:34 |
| fenn | they have a 6x6 grid of control points vs your 2x4 grid, are you sure this dimensionality works with degree=2? | 01:37 |
| nmz787 | anyone here know about NURBS curves? I am trying to produce a parabolic curved channel (like half a cylinder). Using venburbs, this is something I thought would make a parabolic channel, but fails to do anything http://paste.pound-python.org/show/8u5tbHkBaLJbdXKfyOLU/ while this code http://paste.pound-python.org/show/auESqxrEHgdMiHU7S6lH/ produces http://imgur.com/MNTRGmL another view http://imgur.com/pyzVJyz | 01:37 |
| nmz787 | sorry verbnurbs* | 01:37 |
| -!- agentsmith2 [~lolzilla@cpe-24-165-87-208.san.res.rr.com] has quit [] | 01:39 | |
| nmz787 | ugh | 01:39 |
| nmz787 | whoops, wrong channel | 01:39 |
| nmz787 | fenn: no idea, I got some ideas from some crappy shockwave flash demo | 01:40 |
| -!- FourFire [~FourFire@185.7.192.138] has joined ##hplusroadmap | 01:42 | |
| fenn | i seem to recall something from high school geometry about needing 3 points to define a parabola | 01:49 |
| fenn | try a 3x3 grid instead | 01:50 |
| fenn | hm maybe that was to define an arc | 01:54 |
| nmz787 | degree = 3; then len(knots_v) => 10 | 02:00 |
| nmz787 | len knots_u = 9 | 02:00 |
| nmz787 | oh, this is using some other function | 02:01 |
| nmz787 | not nurbsSurface | 02:01 |
| -!- FourFire [~FourFire@185.7.192.138] has quit [Read error: Connection reset by peer] | 02:02 | |
| nmz787 | well, deg 3, len(knots) 10, 6 sets of 6 (x,y,z) points | 02:02 |
| nmz787 | then 6x6 weights of value 1 | 02:02 |
| -!- FAMAS [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 02:31 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has joined ##hplusroadmap | 02:55 | |
| -!- shubhamgoyal [~shubhamgo@nusnet-121-9.dynip.nus.edu.sg] has quit [Remote host closed the connection] | 03:01 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has quit [Quit: Ex-Chat] | 03:22 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has joined ##hplusroadmap | 03:37 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has quit [Remote host closed the connection] | 03:42 | |
| -!- ebowden_ [~ebowden@CPE-60-231-182-230.lns4.dav.bigpond.net.au] has joined ##hplusroadmap | 04:09 | |
| -!- ebowden [~ebowden@CPE-60-231-182-230.lns4.dav.bigpond.net.au] has quit [Read error: Connection reset by peer] | 04:09 | |
| -!- drewbot [~cinch@ec2-54-162-4-118.compute-1.amazonaws.com] has quit [Remote host closed the connection] | 04:09 | |
| -!- drewbot [~cinch@ec2-54-227-213-61.compute-1.amazonaws.com] has joined ##hplusroadmap | 04:09 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has quit [Ping timeout: 245 seconds] | 04:21 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has joined ##hplusroadmap | 04:23 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has quit [Ping timeout: 250 seconds] | 04:27 | |
| -!- delinquentme [~dingo@74.61.157.78] has quit [Ping timeout: 250 seconds] | 04:29 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has joined ##hplusroadmap | 04:37 | |
| -!- thesnark [8dd611e8@gateway/web/freenode/ip.141.214.17.232] has joined ##hplusroadmap | 04:38 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has joined ##hplusroadmap | 04:45 | |
| -!- thesnark is now known as narwh4l | 04:49 | |
| -!- eudoxia [~eudoxia@r167-56-16-88.dialup.adsl.anteldata.net.uy] has joined ##hplusroadmap | 05:00 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has quit [Ping timeout: 244 seconds] | 05:02 | |
| -!- HEx1 [~HEx@hexwab.plus.com] has joined ##hplusroadmap | 05:06 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Ping timeout: 240 seconds] | 05:13 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 05:14 | |
| -!- delinquentme [~dingo@74.61.157.78] has joined ##hplusroadmap | 05:31 | |
| -!- nsh [~lol@wikipedia/nsh] has quit [Read error: Connection reset by peer] | 05:31 | |
| -!- nsh [~lol@2001:41d0:8:c2da::1337] has joined ##hplusroadmap | 05:32 | |
| -!- nsh [~lol@2001:41d0:8:c2da::1337] has quit [Changing host] | 05:41 | |
| -!- nsh [~lol@wikipedia/nsh] has joined ##hplusroadmap | 05:41 | |
| -!- rk[ohio] [~rak@opensource.cse.ohio-state.edu] has quit [Ping timeout: 244 seconds] | 05:46 | |
| kanzure | maaku: yes there are many here who are working on kinematic self-replicating machins (genehacker, fenn, kragen, perhaps myself) | 05:56 |
| kanzure | verbnurbs doesn't have surface-surface intersections, i should have mentioned that to nmz787 | 05:58 |
| -!- delinquentme [~dingo@74.61.157.78] has quit [Ping timeout: 272 seconds] | 06:06 | |
| -!- FAMAS2 [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 06:40 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Disconnected by services] | 06:41 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has joined ##hplusroadmap | 06:41 | |
| -!- FAMAS2 is now known as FAMAS | 06:43 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has quit [Quit: Ex-Chat] | 06:59 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has joined ##hplusroadmap | 07:01 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Ping timeout: 250 seconds] | 07:03 | |
| -!- narwh4l [8dd611e8@gateway/web/freenode/ip.141.214.17.232] has quit [Quit: Page closed] | 07:06 | |
| -!- rk[ohio] [~rak@164.107.116.158] has joined ##hplusroadmap | 07:07 | |
| JayDugger | Good morning. | 07:19 |
| kanzure | hi | 07:19 |
| -!- pete4242 [~smuxi@boole.london.hackspace.org.uk] has joined ##hplusroadmap | 07:22 | |
| -!- cluckj [~cluckj@cpe-24-92-48-18.nycap.res.rr.com] has quit [Quit: Leaving] | 07:22 | |
| kanzure | haha this guy screwed up his homeostasis https://news.ycombinator.com/item?id=8809328 | 07:27 |
| -!- poppingtonic [~poppingto@unaffiliated/poppingtonic] has quit [Read error: Connection reset by peer] | 07:38 | |
| JayDugger | Probably not his best move, no. | 07:39 |
| -!- ebowden_ [~ebowden@CPE-60-231-182-230.lns4.dav.bigpond.net.au] has quit [Remote host closed the connection] | 07:42 | |
| -!- cluckj [~cluckj@cpe-24-92-48-18.nycap.res.rr.com] has joined ##hplusroadmap | 07:47 | |
| -!- eudoxia_ [~eudoxia@r179-25-188-100.dialup.adsl.anteldata.net.uy] has joined ##hplusroadmap | 07:58 | |
| -!- eudoxia [~eudoxia@r167-56-16-88.dialup.adsl.anteldata.net.uy] has quit [Read error: Connection reset by peer] | 07:58 | |
| -!- eudoxia_ [~eudoxia@r179-25-188-100.dialup.adsl.anteldata.net.uy] has quit [Client Quit] | 07:58 | |
| -!- poppingtonic [~poppingto@unaffiliated/poppingtonic] has joined ##hplusroadmap | 08:01 | |
| -!- eudoxia [~eudoxia@r179-25-188-100.dialup.adsl.anteldata.net.uy] has joined ##hplusroadmap | 08:01 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has joined ##hplusroadmap | 08:12 | |
| -!- FAMAS [~FAMAS@182.48.84.40] has quit [Ping timeout: 245 seconds] | 08:22 | |
| -!- juri_ [~juri@vpn166.sdf.org] has quit [Ping timeout: 264 seconds] | 08:52 | |
| -!- juri_ [~juri@vpn166.sdf.org] has joined ##hplusroadmap | 08:59 | |
| andytoshi | kanzure: i'm in vancouver, what's up? | 09:09 |
| jrayhawk_ | Non-shivering thermogenesis has some magical effects on immuneological cortisol sensitivity. | 09:09 |
| jrayhawk_ | There's footage of Wim Hoff getting a lipopolysaccharide injection and shrugging it off. | 09:09 |
| jrayhawk_ | Might have some relation to the mammalian dive reflex. | 09:11 |
| jrayhawk_ | I try to take showers cold whenever I don't have any particular legitimate need of inflammation, but it's an easy habit to fall out of. | 09:12 |
| -!- Viper168_ [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 09:13 | |
| -!- Viper168 [~Viper@unaffiliated/viper168] has quit [Ping timeout: 256 seconds] | 09:15 | |
| -!- Viper168_ [~Viper@unaffiliated/viper168] has quit [Max SendQ exceeded] | 09:16 | |
| -!- Viper168_ [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 09:18 | |
| -!- Viper168_ is now known as Viper168 | 09:22 | |
| kragen | jrayhawk_: unfortunately I think I am missing some context here | 09:25 |
| kragen | does non-shivering thermogenesis increase or decrease immunological cortisol sensitivity? what's the relationship with lipopolysaccharides --- do they stimulate cortisol production, or inflammation (which cortisol would suppress, no?)? | 09:26 |
| kragen | also, kanzure, DNI is "digital-network intelligence" | 09:26 |
| -!- eudoxia [~eudoxia@r179-25-188-100.dialup.adsl.anteldata.net.uy] has quit [Quit: Leaving] | 09:32 | |
| -!- Merovoth [~Merovoth@gateway/tor-sasl/merovoth] has joined ##hplusroadmap | 09:36 | |
| -!- vi [~WashIrvin@58.182.38.58] has joined ##hplusroadmap | 10:15 | |
| -!- eudoxia [~eudoxia@r190-133-117-196.dialup.adsl.anteldata.net.uy] has joined ##hplusroadmap | 10:15 | |
| -!- JayDugger1 [~jwdugger@pool-173-57-55-138.dllstx.fios.verizon.net] has joined ##hplusroadmap | 10:16 | |
| -!- HEx2 [~HEx@hexwab.plus.com] has joined ##hplusroadmap | 10:16 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has quit [Ping timeout: 264 seconds] | 10:27 | |
| -!- Netsplit *.net <-> *.split quits: Qfwfq, JayDugger, HEx1 | 10:27 | |
| -!- strangewarp [~strangewa@c-76-25-206-3.hsd1.co.comcast.net] has joined ##hplusroadmap | 10:27 | |
| -!- strangewarp_ [~strangewa@c-76-25-206-3.hsd1.co.comcast.net] has quit [Ping timeout: 255 seconds] | 10:30 | |
| maaku | kanzure: i mean non-bio replicators. any of your projects described online? | 10:31 |
| -!- dvorkbjel [~viskestel@li607-220.members.linode.com] has quit [Excess Flood] | 10:32 | |
| kanzure | originally the purpose of http://gnusha.org/skdb was to design and build a self-replicating machine | 10:32 |
| kanzure | by looking for cycles in the dependency graphs | 10:33 |
| kanzure | andytoshi: you could hang out with sheena2 if you can find her (she's a bit north of you) | 10:33 |
| -!- dvorkbjel [~viskestel@li607-220.members.linode.com] has joined ##hplusroadmap | 10:35 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has joined ##hplusroadmap | 10:44 | |
| andytoshi | kanzure: sheena2: sure, depending what "a bit north" means :) | 10:48 |
| kanzure | "For people that are fluent in a second language, studies have shown distinct developmental differences in language processing regions of the brain. A new study provides new evidence that programmers are totally brain dead." | 10:48 |
| kanzure | "At first we thought we would place programmers under an fMRI, but that didn't work when we discovered that where their brains were supposed to be instead was 95% water by volume." | 10:50 |
| nmz787 | kanzure: what do you mean about no surface-to-surface intersection? their demo shows a nurbs surface that intersects with a plane | 10:57 |
| nmz787 | kanzure: did you see the pound.python pastes? I have no idea how to make a parabola with NUBRS :P | 10:57 |
| kanzure | .title https://www.youtube.com/watch?v=l4-_vRJ7CQM&t=7m29s | 11:01 |
| yoleaux | Endoscopic Third Ventriculostomy for Hydrocephalus - YouTube | 11:01 |
| kanzure | well surface-surface seems to be on his todo list in todo.txt | 11:01 |
| kanzure | you'll probably have to write your own basic geometry library to use verbnurbs | 11:01 |
| kanzure | i have no idea what this video is | 11:01 |
| -!- FourFire [~FourFire@77.88.71.253] has joined ##hplusroadmap | 11:05 | |
| nmz787 | weird skin effect, not sure where this is happening in the code :/ http://imgur.com/sXVkRnL,si4Rp2r,sraO5Va,EHoZ5XB | 11:16 |
| kanzure | btw he is responsive by email | 11:20 |
| -!- delinquentme [~dingo@74.61.157.78] has joined ##hplusroadmap | 11:25 | |
| -!- Merovoth [~Merovoth@gateway/tor-sasl/merovoth] has quit [Remote host closed the connection] | 11:44 | |
| nmz787 | ok | 11:45 |
| nmz787 | g2g now | 11:45 |
| -!- CheckDavid [uid14990@gateway/web/irccloud.com/x-buaqtdvtmmcfiaah] has joined ##hplusroadmap | 11:45 | |
| -!- Viper168 [~Viper@unaffiliated/viper168] has quit [Ping timeout: 255 seconds] | 11:50 | |
| -!- Merovoth [~Merovoth@gateway/tor-sasl/merovoth] has joined ##hplusroadmap | 11:56 | |
| kanzure | https://twitter.com/devops_jesus but doesn't seem to be as funny as devops_borat | 12:22 |
| kanzure | perfect https://twitter.com/uxyoda | 12:23 |
| kragen | (apparently lipopolysaccharides stimulate cortisol production, so I guess jrayhawk_ is saying that non-shivering thermogenesis suppresses lipopolysaccharide-induced cortisol production based on this Wim Hoff anecdote?) | 12:32 |
| kanzure | nes anti-emulation https://endrift.com/mgba/2014/12/28/classic-nes/ | 13:13 |
| -!- delinquentme [~dingo@74.61.157.78] has quit [Quit: Leaving] | 13:16 | |
| -!- Viper168 [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 13:19 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 245 seconds] | 13:31 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 13:38 | |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 13:41 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 258 seconds] | 13:48 | |
| -!- CheckDavid [uid14990@gateway/web/irccloud.com/x-buaqtdvtmmcfiaah] has quit [Quit: Connection closed for inactivity] | 13:54 | |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Remote host closed the connection] | 13:54 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 13:57 | |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 14:24 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 245 seconds] | 14:29 | |
| -!- delinquentme [~dingo@74.61.157.78] has joined ##hplusroadmap | 14:30 | |
| -!- eudoxia [~eudoxia@r190-133-117-196.dialup.adsl.anteldata.net.uy] has quit [Quit: Leaving] | 14:36 | |
| nmz787 | kragen: re: CAD: turning the quality from 1500 to 2000 alleviated the skin, but now I see that the posts still aren't as cylindrical as they should be. | 14:44 |
| nmz787 | kragen: I wonder if I could maybe render these high-detail areas separately, then stitch the large flat spots by hand with just like 2 huge triangles for each side | 14:45 |
| nmz787 | kragen the STL grew from quality=1500 and 145MB to q=2000 and 152MB | 14:45 |
| kragen | what is quality? | 14:45 |
| nmz787 | some number that I guess increases the number of refinement operations I think | 14:46 |
| kanzure | yes stl is an incredibly inefficient storage format | 14:46 |
| kanzure | you should not plan on using stl for storage or transfer, ever | 14:46 |
| kragen | are you talking about implicitcad here? | 14:46 |
| nmz787 | for calculating floating point operations I think | 14:46 |
| kragen | stl is awesome | 14:46 |
| -!- sheena2 [~home@24.70.52.137] has quit [Ping timeout: 256 seconds] | 14:46 | |
| kanzure | https://bostongazette.files.wordpress.com/2014/02/the-lego-movie-awesome-e1392309318427.png?w=600 | 14:46 |
| kragen | but it's true that you need a lot of triangles to approximate things reasonably | 14:46 |
| kragen | the great thing about stl is that if you have implemented it then you have implemented it | 14:47 |
| nmz787 | yeah implicitcad using the .escad format... though the old main guy replied on how to start getting going with pure haskell https://groups.google.com/forum/#!topic/implicitcad/cWTn01aXqsI | 14:47 |
| kragen | so you can be reasonably sure that if you store an stl model it will still be roughly as accessible in 10 or 20 years as it is now. maybe more | 14:47 |
| kanzure | "I no longer maintain ImplicitCAD. Julia Longtin (who I think is also on this list) does. I will leave further comments to her." haha | 14:48 |
| nmz787 | yeah and implicitcad has been her first foray into haskell | 14:48 |
| nmz787 | I am not sure how much she knows, haven't talked about it | 14:48 |
| kragen | heh, that sounds kind of rough | 14:49 |
| * delinquentme now a member of saltstack-formulas | 14:49 | |
| kanzure | maybe the weird non-haskell stuff was added by this non-haskell person | 14:49 |
| delinquentme | #erffishul | 14:49 |
| delinquentme | lel haskell | 14:49 |
| nmz787 | delinquentme: want a 153MB STL file of a microfluidic? | 14:49 |
| delinquentme | feedme | 14:49 |
| kanzure | man why does nobody listen to me | 14:50 |
| kanzure | do not transfer stl files | 14:50 |
| delinquentme | lulz ... is that the thing you posted? | 14:50 |
| nmz787 | :D | 14:50 |
| kanzure | that is morally evil of you | 14:50 |
| delinquentme | why? | 14:50 |
| kanzure | kragen: what the hell do i have to say to get people to listen | 14:50 |
| nmz787 | it took a while to render kanzure | 14:50 |
| nmz787 | internets is what I pay for every month! | 14:50 |
| kanzure | you don't want to render -_- | 14:50 |
| kragen | kanzure: it would help if you were right | 14:50 |
| delinquentme | ^ | 14:50 |
| delinquentme | lulz | 14:50 |
| kanzure | transferring stl files is like transferring compiled binaries | 14:50 |
| kragen | yes | 14:50 |
| kanzure | it is just evil and corrupt of you to do | 14:50 |
| delinquentme | fun? | 14:50 |
| kragen | that is a very good analogy | 14:50 |
| kanzure | your source code is like <10 kb | 14:51 |
| nmz787 | kanzure: windows is a binary on tos of end-user media | 14:51 |
| nmz787 | disks are a thing | 14:51 |
| kragen | binaries compiled for brainfuck or some similarly stable machine | 14:51 |
| kanzure | stop using windows | 14:51 |
| kragen | maybe ms-dos 3.3 | 14:51 |
| nmz787 | well i am on linux now | 14:51 |
| nmz787 | so your juju doesn't apply | 14:51 |
| kragen | you are not quite guaranteed that if you send someone an stl file then it will render the same for them as for you | 14:51 |
| kanzure | it's not like your little arduino powering your reprap is going to be okay with a 2 gigabyte stl file | 14:51 |
| kragen | regardless of what version of the compiler and libraries they have installed or what os they are running | 14:52 |
| nmz787 | kanzure: i rendered an SVG too | 14:52 |
| kanzure | heh | 14:52 |
| delinquentme | listen its suspended in cryogenic mineral oil and OC'd to 10x | 14:52 |
| kragen | svg ;) | 14:52 |
| nmz787 | and it can do g-cdoe | 14:52 |
| kanzure | i'll let kragen rant about svg | 14:52 |
| nmz787 | g-code | 14:52 |
| kanzure | since he has been manually doing svg things lately | 14:52 |
| delinquentme | I want a side project selling artsy fanless CPU coolers | 14:52 |
| nmz787 | though I haven't tried that to see how large it would be | 14:52 |
| kragen | nmz787: are you doing svg in 3d somehow | 14:53 |
| -!- FourFire [~FourFire@77.88.71.253] has quit [Ping timeout: 244 seconds] | 14:53 | |
| kragen | because that would be cool | 14:53 |
| delinquentme | ideally using some navier-stokes property to increase the cooling effects | 14:53 |
| nmz787 | kragen: https://github.com/nmz787/microfluidic-cad/blob/master/implicitCAD/output/tobacco_mesophyll_protoplast_fusion_device.svg | 14:53 |
| nmz787 | kragen: no it's just the different layers of the device | 14:53 |
| * delinquentme is kanzure and wondering why nobdy listnz | 14:53 | |
| nmz787 | kragen: it can be broken up by extrusion operations essentially | 14:53 |
| kragen | oh i see | 14:53 |
| kanzure | delinquentme: instead of asking him for the 150 MB file just get the source code by using `git clone https://github.com/nmz787/microfluidic-cad` | 14:54 |
| * kragen gives delinquentme a hug | 14:54 | |
| kanzure | btw does github actually render your stl file | 14:54 |
| kanzure | or is that in-browser rendering | 14:54 |
| kragen | you know stl would be a great deal more compact if someone compressed the flonums with some kind of linear prediction | 14:54 |
| kragen | they use in-browser rendering | 14:54 |
| kanzure | hopefully you are not committing that file | 14:54 |
| nmz787 | these are the output formats it know's about https://github.com/colah/ImplicitCAD/blob/318d96a8244279c4c2023dd6d4b16aebc96e45cf/Graphics/Implicit.hs#L56 | 14:54 |
| kanzure | kragen: how am i wrong about st | 14:55 |
| kanzure | *stl | 14:55 |
| nmz787 | kanzure: nope, not the big one | 14:55 |
| nmz787 | i committed the 1 or 2 MB sine wave thing | 14:55 |
| kanzure | aaaaaaa | 14:55 |
| kragen | kanzure: distibuting binaries is a very good idea, even if perhaps less important than distributing source code | 14:56 |
| kragen | and often much more convenient | 14:56 |
| nmz787 | delinquentme: yeah if you wanted to setup implicitcad you could also render that microfluidic with this file https://github.com/nmz787/microfluidic-cad/blob/master/implicitCAD/tobacco_mesophyll_protoplast_fusion_device.escad | 14:56 |
| delinquentme | nmz787, you lost me on that file title | 14:57 |
| kanzure | the binary analogy only works when talking about source code, since you have already established that it is not actually "binary compatible" on different execution platforms | 14:57 |
| * delinquentme le hugs kragen back | 14:57 | |
| nmz787 | delinquentme: at the moment to get a decent STL you need the quality to be at 2000 at least | 14:57 |
| nmz787 | delinquentme: then use meshlab to open the STL | 14:57 |
| delinquentme | no I mean ... tobacco mesophyll protoplast fusion | 14:57 |
| delinquentme | like I've found some good drugs | 14:57 |
| delinquentme | but not that good | 14:57 |
| nmz787 | it's not a drug | 14:58 |
| nmz787 | see diybio recent talks | 14:58 |
| nmz787 | it's something to fuse protoplasts in a microfluidic then filter the unfused (and thus smaller by about half the volume) | 14:58 |
| kragen | it is very binary compatible, although not perfectly | 14:58 |
| nmz787 | using column pressure differential for flow between central input and radial outputs | 14:59 |
| kragen | there are stl files that e.g. slic3r and openscad choke on | 14:59 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 14:59 | |
| nmz787 | so basically you put a drop in the center and keep the center topped off | 14:59 |
| delinquentme | actually im trying to get this stupid influxdb example for configuring grafana working | 14:59 |
| delinquentme | kanzoo you've grafana'd b4 ? | 14:59 |
| kanzure | delinquentme: ask and ye shall receive | 14:59 |
| kanzure | i've been using influxdb a little here and there | 15:00 |
| kanzure | and grafana | 15:00 |
| nmz787 | WHAT, i just learned ubuntu (or maybe just xfce) has alt+middle mouse scroll to zoom like on a mac | 15:00 |
| kragen | what are you using influxdb for | 15:00 |
| nmz787 | cool! | 15:00 |
| kanzure | this is on my list http://www.philipotoole.com/influxdb-and-grafana-howto/ | 15:00 |
| delinquentme | yeah I saw that one too | 15:01 |
| kanzure | kragen: analysis from data firehose from trades | 15:01 |
| delinquentme | I think I just need to sketch up a network diagram -- as its using influxdb, grafana, graphite, and some other DB | 15:02 |
| kanzure | my statement is not entirely true; it's a partial answer | 15:02 |
| delinquentme | and i THINK thats the extent of everything which needs to be installed | 15:02 |
| kragen | oh, are you getting it to perform reasonably now | 15:02 |
| nmz787 | lata! g2g get my phone screen replaced | 15:02 |
| delinquentme | exceptional: https://www.youtube.com/watch?v=lG3Qp_ceMHk | 15:03 |
| kanzure | has been nanosecond resolution for quite a while now | 15:03 |
| kragen | i was very disappoined with influxdb when i tried it earlier this year | 15:03 |
| kanzure | this is mostly for extra regulatory reasons | 15:03 |
| kragen | i had 3.2 million data points and inserting them took 4 hours | 15:03 |
| kanzure | delinquentme: if you are lazy maybe just use https://metrics.librato.com/ | 15:03 |
| kragen | historical 30-second bars of gold futures, fwiw. i was just inserting the closing prices | 15:03 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 245 seconds] | 15:04 | |
| kanzure | where was the data from? | 15:04 |
| kanzure | cme? | 15:04 |
| kragen | ultimately yes | 15:04 |
| kragen | not relevant though | 15:05 |
| kanzure | shrug just curious | 15:05 |
| kanzure | a fountain of historical data would be a nice thing to find | 15:05 |
| kanzure | but is somewhat like search for fountain of youth | 15:05 |
| kragen | yeah, historical data is hard to come by | 15:05 |
| kragen | iqfeed has pretty decent and cheap data | 15:05 |
| kanzure | hm | 15:06 |
| kragen | they used to also have a satellite link full feed service for real-time data | 15:06 |
| delinquentme | nanosecond resolution from what kanzure ? | 15:06 |
| kragen | ended a few years back because internet is good enough | 15:06 |
| kanzure | delinquentme: mad science stuff | 15:06 |
| kragen | for the timestamps you store in influxdb, delinquentme | 15:06 |
| delinquentme | jeebuz | 15:06 |
| kanzure | no | 15:06 |
| delinquentme | kragen, -1 | 15:07 |
| kanzure | other thing | 15:07 |
| kragen | oh, heh | 15:07 |
| kragen | hat makes more sense | 15:07 |
| kanzure | i interpreted "oh, are you getting it to perform reasonably now" differently | 15:07 |
| kragen | at the time i was only able to insert about 200 points per second and queries would take minutes | 15:08 |
| kanzure | ouch | 15:08 |
| kragen | so i am wondering if influxdb is delivering reasonable performance for that kind of data now | 15:08 |
| kragen | yeah, i was sad that i wasted so much time trying to find a usable tsdb | 15:08 |
| kanzure | did you have indices? | 15:12 |
| kragen | i did not explicitly create any indices; i suspect that it did not have any at the time | 15:14 |
| -!- pete4242 [~smuxi@boole.london.hackspace.org.uk] has quit [Remote host closed the connection] | 15:14 | |
| kragen | i mean influxdb, the software, not my instance of it | 15:15 |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has quit [Remote host closed the connection] | 15:15 | |
| kragen | query times increased linearly with the amount of data in the database | 15:16 |
| kragen | this was in march | 15:16 |
| kanzure | this seems like a property that is not ideal for a database to have | 15:16 |
| kragen | what are you experiencing | 15:18 |
| kanzure | haven't investigated, to be honest. set things up, on to the next windmills to tilt at. | 15:19 |
| kanzure | someone else will prolly look soon | 15:19 |
| kragen | you would be noticing if you were experiencing such poor performance as i did, though, wouldn't you | 15:20 |
| kanzure | nope, because queries are happening somewhere else entirely | 15:20 |
| kanzure | not using it as an "active" component | 15:21 |
| kanzure | if that makes sense | 15:21 |
| kragen | you are just dumping data into it and hoping that you can get it back later | 15:22 |
| -!- FourFire [~FourFire@109.179.63.79.tmi.telenormobil.no] has joined ##hplusroadmap | 15:24 | |
| -!- chris_99 [~chris_99@unaffiliated/chris-99/x-3062929] has quit [Quit: Ex-Chat] | 15:26 | |
| delinquentme | influx db running on a clean instance of google cloud. port 8083 is open to the outside and I can load the IP and see the InfluxDB Administration interface | 15:30 |
| delinquentme | however I cannot login with root/root | 15:30 |
| delinquentme | nor are login attempts reflected in the /opt/influxdb/shared/log.txt | 15:30 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 15:31 | |
| kanzure | admin / password | 15:31 |
| delinquentme | nada | 15:32 |
| delinquentme | http://107.178.215.76:8083/ | 15:32 |
| kanzure | connection refused | 15:34 |
| delinquentme | wat. | 15:34 |
| delinquentme | and you've got the port there as well? yeah IDK then ... its definitely open to the interwebs | 15:35 |
| kanzure | are you passing a database name when logging in? | 15:35 |
| delinquentme | nope | 15:35 |
| kanzure | "You can run InfluxDB with the environment variabe DEFAULT_ROOT_PWD set to whatever root password you'd like, note that this is an undocumented feature. This only works the first time you run InfluxDB or if you run influxdb --reset-root." | 15:36 |
| kanzure | hahah https://github.com/influxdb/influxdb/issues/1012 | 15:36 |
| kanzure | awesome | 15:36 |
| kanzure | nmz787: in the future, cad wil be easier | 15:39 |
| archels | can I quote you on that? | 15:43 |
| kanzure | yes | 15:44 |
| delinquentme | I just spelled rules " Rools " | 15:46 |
| delinquentme | idk. | 15:46 |
| delinquentme | ok so I change the default bounding IP to 127.0.0.1 and it fails to resolve at the public facing URL ... but I want it to | 15:56 |
| delinquentme | Job for iptables right? | 15:56 |
| kanzure | er, sounds like you want it to bind to 107.178.215.76 to me | 15:58 |
| kanzure | unless you want to only use that when logging in to the machine | 15:58 |
| kanzure | ssh relay stuff | 15:58 |
| delinquentme | but im confused as I'd expect 127.0.0.1 to bind to whatever the external IP is | 16:02 |
| kanzure | 127.0.0.1 is localhost | 16:03 |
| kanzure | you are not going to convince the internet to route 127.0.0.1 to your box | 16:03 |
| kanzure | i mean, you can try..... and i encourage you to... | 16:03 |
| delinquentme | but all of these operations are local to the machine ... once that request hits the machines external IP ... that is then localhost / 127.0.0.1 no? | 16:05 |
| -!- Evoril [~Evoril@86-45-222-8-dynamic.agg2.crw.prp-wtd.eircom.net] has joined ##hplusroadmap | 16:05 | |
| kanzure | which request are you talking about? | 16:05 |
| delinquentme | the initial question pertained to binding influx to an ip other than 0.0.0.0 | 16:06 |
| -!- Evoril [~Evoril@86-45-222-8-dynamic.agg2.crw.prp-wtd.eircom.net] has quit [Client Quit] | 16:06 | |
| kanzure | so, are you using salt? | 16:06 |
| delinquentme | yarp | 16:09 |
| delinquentme | and I know there are formulas for it | 16:09 |
| kanzure | what's the behavior you want here? | 16:10 |
| kanzure | if you only bind to 127.0.0.1 then you'll have to ssh into the box before making http requests to localhost:8083 | 16:10 |
| delinquentme | so either I should bind the internally-running influx db to 0.0.0.0, or the servers externally facing IP | 16:11 |
| delinquentme | 0.0.0.0 seems like its asecurity issue | 16:12 |
| kanzure | depends on how your infrastructure is setup | 16:14 |
| kanzure | if you have something else always handling traffic before it hits this server then you can probably safely set to 0.0.0.0 | 16:15 |
| -!- ebowden_ [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 16:22 | |
| -!- Viper168 [~Viper@unaffiliated/viper168] has quit [Read error: Connection timed out] | 16:22 | |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Ping timeout: 264 seconds] | 16:25 | |
| delinquentme | kanzure, got it +1 | 16:25 |
| delinquentme | makes no sense : | 16:33 |
| delinquentme | 2014/12/30 00:32:52 [crit] 3197#0: *12 stat() "/root/grafana-1.9.0/index.html" failed (13: Permission denied), client: 74.61.157.78, server: localhost, request: "GET /favicon.ico HTTP/1.1", host: "107.178.215.76" | 16:33 |
| delinquentme | yet I've $ chmod -R /root/grafana-1.9.0/ + restarted nginx | 16:34 |
| delinquentme | still that comes up when I try loading | 16:34 |
| kanzure | /root might have a sticky bit set? | 16:34 |
| delinquentme | yeah just chmod 0755 /root/ | 16:36 |
| delinquentme | http://107.178.215.76/ | 16:36 |
| delinquentme | so it loads .. but zero info | 16:36 |
| delinquentme | TIl sticky bit | 16:36 |
| delinquentme | and now I want a pecan bun | 16:36 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Ping timeout: 244 seconds] | 16:37 | |
| delinquentme | GOLD! | 16:38 |
| -!- Viper168 [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 16:39 | |
| kanzure | stickybit should be okay | 16:39 |
| kanzure | instead don't use /root | 16:39 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 16:40 | |
| delinquentme | yeah /root isn't best ... but this is first iter | 16:41 |
| delinquentme | OK RELOACING | 16:41 |
| delinquentme | WOOOOOOOO | 16:41 |
| -!- delinquentme [~dingo@74.61.157.78] has quit [Ping timeout: 245 seconds] | 16:46 | |
| kanzure | subtext: he got kicked out of the coffee shop, i bet | 16:46 |
| -!- delinquentme [~dingo@74.61.157.78] has joined ##hplusroadmap | 16:57 | |
| -!- JayDugger1 [~jwdugger@pool-173-57-55-138.dllstx.fios.verizon.net] has quit [Quit: Leaving.] | 16:57 | |
| -!- ebowden_ [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Remote host closed the connection] | 17:02 | |
| -!- FourFire [~FourFire@109.179.63.79.tmi.telenormobil.no] has quit [Quit: Leaving] | 17:15 | |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 17:21 | |
| jrayhawk_ | do any of those sysadminny words merit my attention | 17:28 |
| jrayhawk_ | there sure are a lot of them | 17:28 |
| -!- juri_ [~juri@vpn166.sdf.org] has quit [Ping timeout: 245 seconds] | 17:38 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has joined ##hplusroadmap | 17:39 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has quit [Ping timeout: 255 seconds] | 17:43 | |
| -!- juri_ [~juri@vpn166.sdf.org] has joined ##hplusroadmap | 17:45 | |
| -!- shubhamgoyal [~shubhamgo@118.189.209.93] has joined ##hplusroadmap | 17:46 | |
| delinquentme | so. if influx db is configured correctly .. and the db itself is running on port 8086 .. I shouldn't have any issues pinging it from within the machine ... right? | 17:46 |
| delinquentme | at current 8086 is returning 404 .. that shouldn't be happening | 17:47 |
| fenn | jrayhawk_: "For increase revenue we are introduce paywall between dev team and ops team." | 18:05 |
| jrayhawk_ | that's basically what amazon did | 18:07 |
| jrayhawk_ | seems to have worked out pretty well for them, actually | 18:07 |
| fenn | you mean by making AWS? | 18:07 |
| fenn | or their "everything is a platform" API bonanza | 18:07 |
| jrayhawk_ | Yeah. All of that has internal accounting, too. | 18:08 |
| jrayhawk_ | I haven't studied it in great detail, but presumably it's a good framework for incentivizing good architecture (modularity, reusability, public SaaS availability, being able to quantify value) | 18:12 |
| fenn | the wim hoff thing is interesting | 18:12 |
| fenn | .title http://www.pnas.org/content/111/20/7379.abstract | 18:12 |
| yoleaux | Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans | 18:12 |
| fenn | it actually makes sense too | 18:12 |
| fenn | i also have no idea how to do it, and hate the cold | 18:13 |
| fenn | like flexing a muscle that doesn't exist | 18:13 |
| jrayhawk_ | hormetic cold stresses will build BAT | 18:14 |
| kragen | i do this | 18:14 |
| fenn | what's BAT | 18:14 |
| jrayhawk_ | brown adipose tissue | 18:14 |
| kragen | i go all winter in flip-flops and shorts. everyone looks at me like i'm crazy | 18:14 |
| kragen | not to the extent of wim hof | 18:14 |
| kragen | i mean, nobody does | 18:14 |
| fenn | i go all winter in multiple layers of clothing and a russian tanker helmet | 18:15 |
| jrayhawk_ | yeah, he's an interesting but wacky outlier | 18:15 |
| kragen | i don't think he's that wacky | 18:15 |
| kragen | from the little i know, anyway | 18:15 |
| kragen | just more dedicated | 18:15 |
| kragen | basically when i'm cold i let myself be uncomfortable, maybe do some breathing exercises | 18:16 |
| kragen | if it gets bad, like i'm shivering involuntarily, i put on more clothes | 18:16 |
| delinquentme | kragen, meditation | 18:16 |
| fenn | doesn't argentina get mild winters because of the ocean currents | 18:16 |
| jrayhawk_ | .title http://www.jci.org/articles/view/68993 | 18:16 |
| yoleaux | JCI - Cold acclimation recruits human brown fat and increases nonshivering thermogenesis | 18:16 |
| delinquentme | I sat in a guided meditation once and had to strip layers off bc got too warm | 18:16 |
| delinquentme | ooooo | 18:16 |
| jrayhawk_ | .title http://www.jci.org/articles/view/67803 | 18:16 |
| yoleaux | JCI - Recruited brown adipose tissue as an antiobesity agent in humans | 18:16 |
| jrayhawk_ | which obviously makes sense; decrease in cytokines increases hypothalamic leptin sensitivity | 18:17 |
| jrayhawk_ | .title http://www.jci.org/articles/view/68993 | 18:18 |
| yoleaux | JCI - Cold acclimation recruits human brown fat and increases nonshivering thermogenesis | 18:18 |
| jrayhawk_ | .title http://www.jci.org/articles/view/67803 | 18:18 |
| yoleaux | JCI - Recruited brown adipose tissue as an antiobesity agent in humans | 18:18 |
| jrayhawk_ | argh | 18:18 |
| jrayhawk_ | wrong paste buffers | 18:18 |
| kanzure | jrayhawk_: nah none of those words merit your attention | 18:18 |
| kragen | fenn: yeah, it isn't that cold here. https://en.wikipedia.org/wiki/Buenos_Aires#Climate | 18:18 |
| kanzure | jrayhawk_: although we were talking about null hypotheses stuff yesterday | 18:18 |
| kanzure | there was some ambiguity that someone wanted resolved and it was about a thing | 18:18 |
| fenn | 45F is not cold | 18:19 |
| kanzure | no | 18:19 |
| kanzure | maybe with high winds | 18:19 |
| kragen | no, despite the name of the city, we don't have high winds | 18:20 |
| jrayhawk_ | mammalian dive reflex is water on the face at <60F, which is probably related | 18:20 |
| kragen | it's full of skyscrapers | 18:20 |
| kanzure | you mean skytouchers? | 18:20 |
| fenn | upgoers? | 18:20 |
| kanzure | skyfondlers | 18:20 |
| kragen | up-be-ers | 18:21 |
| kanzure | 16:27 < fenn> i mean i think i get what he's trying to say, but it doesn't match my understanding of "null hypothesis" | 18:22 |
| kanzure | 16:26 < fenn> < jrayhawk_> The formation of a good working null hypothesis for how sugar is supposed to work necessarily involves phenolics. | 18:22 |
| kanzure | 16:27 < fenn> this sentence doesn't make sense to me | 18:22 |
| kanzure | whoops, temporal convolution | 18:22 |
| fenn | hey i am busy reading about brown adipose tissue now | 18:22 |
| fenn | not silly philosophy stuff | 18:23 |
| kanzure | not silly sugar shit | 18:23 |
| fenn | shilly sugar sit | 18:23 |
| jrayhawk_ | "i mean i think i get what he's trying to say" if you have a better way to say it, i will gladly steal it from you | 18:24 |
| kanzure | "they were wrong" | 18:24 |
| fenn | the only human evolutionary exposure to fructose was coincident with polyphenols or flavonoids | 18:25 |
| fenn | because berries | 18:26 |
| jrayhawk_ | after mastering fire, honey was possibly more important, but the same basic principle applies | 18:26 |
| fenn | i dunno about honey, either nutritionally or its availability | 18:27 |
| fenn | bears seem more interested in the baby bees than the honey | 18:27 |
| fenn | also, natural honey has all sorts of black shit in it | 18:28 |
| jrayhawk_ | http://wholehealthsource.blogspot.com/2011/02/polyphenols-hormesis-and-disease-part-i.html and http://wholehealthsource.blogspot.com/2011/02/polyphenols-hormesis-and-disease-part.html are good summaries of the confusing state of polyphenol research | 18:28 |
| fenn | oh "polyphenol binding proteins in saliva" must be why persimmons make your mouth pucker | 18:30 |
| fenn | .ety pucker | 18:31 |
| yoleaux | pucker (v.): "1590s, "prob. earlier in colloquial use" [OED], possibly a frequentative form of pock, dialectal variant of poke "bag, sack" (see poke (n.1)), which would give it the same notion as in purse (v.)." — http://etymonline.com/index.php?term=pucker | 18:31 |
| -!- Evoril [~Evoril@86-45-222-8-dynamic.agg2.crw.prp-wtd.eircom.net] has joined ##hplusroadmap | 18:32 | |
| delinquentme | If i've got all of my applications running locally on a machine ... I don't need to worry about enabling CORS right?? | 18:33 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/12617614 bioavailability of phenolics in honey | 18:33 |
| paperbot | http://libgen.org/scimag/get.php?doi=10.1021%2Fjf025928k | 18:33 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/12935325 improves oxidative stress, blood sugar management | 18:33 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/12935324 decreases inflammation | 18:33 |
| paperbot | http://libgen.org/scimag/get.php?doi=10.1089%2F109662003322233549 | 18:33 |
| paperbot | http://libgen.org/scimag/get.php?doi=10.1089%2F109662003322233530 | 18:33 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/18454257 general metabolic improvements over sucrose | 18:33 |
| paperbot | http://libgen.org/scimag/get.php?doi=10.1100%2Ftsw.2008.64 | 18:33 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/15117561 general metabolic improvements over sucrose | 18:33 |
| paperbot | http://libgen.org/scimag/get.php?doi=10.1089%2F109662004322984789 | 18:33 |
| fenn | jrayhawk how do you organize your bookmarks | 18:33 |
| jrayhawk_ | i don't; some of these i just remember how to search for; this particular topic i am ripping links out of an email i composed a few months ago | 18:34 |
| kanzure | https://github.com/davidlazar/jotmuch | 18:35 |
| jrayhawk_ | i feel like i should probably be wikifying these things | 18:35 |
| kanzure | feel free to abuse diyhpluswiki | 18:35 |
| kanzure | especially for comments like "Someone should fix this metabolism because it is stupid" | 18:35 |
| fenn | yeah nutritional modifications is really low hanging fruit | 18:36 |
| * fenn savagely beheads the pun elf | 18:37 | |
| jrayhawk_ | paperbot: http://www.ncbi.nlm.nih.gov/pubmed/8672404 | 18:39 |
| fenn | .title | 18:40 |
| yoleaux | Honey revisited: a reappraisal of honey in pre-industrial diets. - PubMed - NCBI | 18:40 |
| fenn | apparently paperbot only answers if you don't prefix with paperbot: now? | 18:40 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/8672404 | 18:40 |
| jrayhawk_ | i have to play hard to get | 18:40 |
| fenn | http://www.ncbi.nlm.nih.gov/pubmed/8672404 test | 18:41 |
| jrayhawk_ | maybe i crashed it | 18:41 |
| fenn | http://www.ncbi.nlm.nih.gov/pubmed/8672404 test test | 18:41 |
| * fenn shrugs | 18:41 | |
| jrayhawk_ | unpaywalled anyway | 18:42 |
| fenn | who has time to read papers anyway | 18:42 |
| jrayhawk_ | "The Mbuty pygmies of the Congo obtain as much as 80% of their dietary energy from honey during the honey season (Crane, 1983), but this lasts for only 2 months out of the year (Turnbull, 1963)." | 18:43 |
| jrayhawk_ | s/Mbuty/Mbuti/ | 18:43 |
| jrayhawk_ | jesus christ that sounds disgusting | 18:44 |
| fenn | yeah but watching them go after the nests makes it clear that humans weren't made for this activity | 18:44 |
| jrayhawk_ | what the hell are you talking about | 18:44 |
| fenn | they get stung hundreds of times and fall out of trees | 18:44 |
| jrayhawk_ | bees are knocked out by smoke | 18:45 |
| delinquentme | I dont party enough when things work as expected. | 18:46 |
| delinquentme | im gonna change that right now. | 18:46 |
| delinquentme | ROFL | 18:46 |
| delinquentme | one comma | 18:46 |
| fenn | delinquentme: just be sure to take your B12 pills after drowning in nitrous | 18:47 |
| delinquentme | http://107.178.215.76/#/dashboard/file/default.json | 18:47 |
| * delinquentme droolies | 18:47 | |
| fenn | it loads very slowly | 18:48 |
| delinquentme | it does | 18:48 |
| fenn | i dig the color scheme | 18:48 |
| delinquentme | was all me | 18:49 |
| delinquentme | not really though | 18:49 |
| delinquentme | itll look better once I get data points loaded | 18:49 |
| delinquentme | BUT right now ... its time to make dinnR | 18:49 |
| delinquentme | taking it down bc I dont trust you guy s:D | 18:50 |
| fenn | pff | 18:50 |
| fenn | what's a little hacking between friends | 18:50 |
| delinquentme | rulf | 18:52 |
| -!- Evoril [~Evoril@86-45-222-8-dynamic.agg2.crw.prp-wtd.eircom.net] has quit [Quit: Leaving] | 18:54 | |
| kanzure | http://i.imgur.com/j61IJdX.jpg | 18:57 |
| kanzure | hacking just shows how much i care | 18:59 |
| delinquentme | any of us in here have a connect to andreesen? | 19:13 |
| delinquentme | or someone with a shitload of cash ? | 19:13 |
| kanzure | show me the pitch | 19:14 |
| delinquentme | cant :D | 19:14 |
| delinquentme | pre patent | 19:14 |
| kanzure | then there's no way you're going to get an intro | 19:14 |
| kanzure | otherwise i burn my connections | 19:14 |
| delinquentme | yeah the patent is staying quiet | 19:14 |
| kanzure | so let me get this straight: you want me to intro you to unfathomably wealthy people, without telling me anything | 19:15 |
| delinquentme | im not sure what I can say about it | 19:15 |
| delinquentme | kanzure, have I asked you for an intro before? | 19:15 |
| kanzure | in fact yes | 19:15 |
| delinquentme | to investors? | 19:15 |
| kanzure | nope, but that doesn't matter | 19:15 |
| delinquentme | lel | 19:15 |
| kanzure | this is how intros work: you talk to the person giving an intro, and the person routes you to wealthy people | 19:15 |
| delinquentme | well ! | 19:15 |
| delinquentme | let that be an indication :D | 19:15 |
| delinquentme | true | 19:16 |
| delinquentme | i did this with jolly as well | 19:16 |
| delinquentme | and he got too nosy | 19:16 |
| delinquentme | nosey* | 19:16 |
| delinquentme | so I said fuck it | 19:16 |
| kanzure | if you are worried about people leaking details then you need a better plan | 19:16 |
| delinquentme | and kanzure we both know how ideas in hard sci aren't the same as they are in #startupLandia | 19:16 |
| kanzure | no different | 19:16 |
| delinquentme | I'm worried about one of the best connected nerds on the hard tech internet leaking info | 19:17 |
| delinquentme | fucking ues | 19:17 |
| delinquentme | ues = yes | 19:17 |
| delinquentme | Yes, I am worried :D | 19:17 |
| fenn | nobody cares about your idea | 19:17 |
| fenn | sheesh | 19:17 |
| kanzure | all intros leak | 19:17 |
| kanzure | that's the whole point of an intro | 19:17 |
| kanzure | you want unfathomably wealthy people excited about your idea | 19:17 |
| delinquentme | id have to ask people first | 19:17 |
| delinquentme | 3 engineers and a biochemist | 19:17 |
| fenn | kanzure is that han solo wearing a suit? | 19:18 |
| delinquentme | whos your contact kanz? | 19:18 |
| delinquentme | we're not interested in musk | 19:18 |
| delinquentme | as that connections already there | 19:18 |
| kanzure | er, i know many people... and which ones i route to depends on what the fuck it is | 19:18 |
| fenn | did chewbacca finally get that hair removal procedure | 19:18 |
| kanzure | fenn: disney ceo | 19:18 |
| fenn | it looks like a painting | 19:18 |
| kanzure | it is definitely photoshopped | 19:19 |
| fenn | maybe just dumb HDR | 19:19 |
| kanzure | delinquentme: also, *real* leaks are super bad and damage my reputation | 19:19 |
| delinquentme | true | 19:19 |
| kanzure | everyone and their dog sends around slide decks | 19:19 |
| delinquentme | kanzure, i need something to whet their appetites | 19:20 |
| kanzure | http://diyhpl.us/~bryan/deck1.pdf | 19:20 |
| -!- balrog [~balrog@discferret/developer/balrog] has quit [Ping timeout: 258 seconds] | 19:20 | |
| delinquentme | kanzure, thats not the investors :D | 19:21 |
| fenn | .title youtu.be/8-OR0QppWKA | 19:21 |
| yoleaux | Towards General Purpose Reconfigurable Computing on Novena - FPGAs for Everybody with Novena [31c3] - YouTube | 19:21 |
| fenn | https://events.ccc.de/congress/2014/Fahrplan/events/6412.html copied here because ccc is slow http://fennetic.net/irc/31c3_Space-time_Adventures_on_Novena-7.pdf | 19:22 |
| jrayhawk_ | the problem with wikifying this stuff is that i would want to insert whole papers, and i can't do that safely publicly | 19:23 |
| kanzure | you could link to papers? | 19:23 |
| kanzure | also, quoting is pretty okay | 19:23 |
| -!- balrog [~balrog@discferret/developer/balrog] has joined ##hplusroadmap | 19:23 | |
| kragen | how do squirrels find nuts they bury | 19:24 |
| kragen | do they just reember six months later | 19:24 |
| kanzure | how likely would it be for "random insertion of vitamin production metabolism" to work? | 19:24 |
| jrayhawk_ | i guess i should make a private repo and then git-filter-branch it to publish it | 19:24 |
| kanzure | kragen: at the moment neuroscience has very few ideas about you remember your own name, much less squirrels burying nuts | 19:24 |
| kragen | some days i don't | 19:25 |
| kanzure | jrayhawk_: or you could just have a private branch | 19:25 |
| fenn | delinquentme: you can apply for a provisional patent and it costs less, but keeps you safe from prior art claims (why am i advising people on patents?) | 19:25 |
| kanzure | fenn: now send him an invoice | 19:26 |
| fenn | that'll be 1% equity please | 19:26 |
| kragen | in theory publishing it is sufficient to keep you safe from prior art claims in the usa | 19:26 |
| kanzure | "3 minutes of patent advice, $250.00 + $5000 retainer + 0.1% equity" | 19:26 |
| jrayhawk_ | i would kinda like to attract other meritous contributors, which would take a while with word-of-mouth | 19:26 |
| delinquentme | were waiting for the patent to finish | 19:26 |
| jrayhawk_ | i could get fenn onboard pretty quick, presumably | 19:26 |
| kanzure | jrayhawk_: you could harass fenn | 19:26 |
| kanzure | yeah | 19:26 |
| delinquentme | but this is also a startup -- not intelectual ventures | 19:26 |
| kanzure | delinquentme: you should ask the other team members to loop you in on conversations with investors so you can see how this game is played | 19:27 |
| kanzure | delinquentme: right now i get the impression that you have ideas about how this game works that don't map to reality | 19:27 |
| kragen | yes, that is super good advice | 19:27 |
| kragen | the most valuable thing you can get out of your first startup is investor face time | 19:28 |
| kanzure | the likelihood of them looping you in is pretty small, but meh | 19:28 |
| kragen | not just because you get to know investors but because you get to see, as kanzure says, how the game is played | 19:28 |
| kanzure | you could offer to provide some service, like follow-up scheduling and shit | 19:28 |
| kanzure | they would appreciate that | 19:28 |
| kragen | it depends on your relationship with them and what kind of impression they think you'll make | 19:28 |
| kanzure | right... best to go with "complete silence" or something at first. | 19:29 |
| kragen | fenn, http://m.theatlantic.com/magazine/archive/2015/01/does-global-warming-make-me-look-fat/383509/ on exposing yourself to cold | 19:29 |
| kanzure | that's from the future and therefore unacceptable | 19:29 |
| kanzure | mothers against time travel | 19:30 |
| fenn | "The sturdy Han Solo–style garment" | 19:30 |
| fenn | the universe is trying to tell me something | 19:30 |
| kanzure | quick, find your decoder ring! | 19:30 |
| fenn | it's saying eat more ice cream i think | 19:30 |
| kragen | everything on this channel is from the future, kanzure | 19:30 |
| jrayhawk_ | FWIW i found cold thermogenesis a lot more pleasant in ketosis | 19:31 |
| kragen | quick, eat your decoder ring | 19:31 |
| kragen | that's interesting, jrayhawk_ | 19:31 |
| jrayhawk_ | the threshold for glycolytic thermogenesis was a lot harder to hit | 19:31 |
| kragen | you mean you had to be a lot colder before you would start to upregulate your metabolism | 19:32 |
| kragen | that seems strange since i thought one of the major supposed benefits of ketosis was that it's less responsive, i.e. changes less slowly | 19:33 |
| kragen | sorry for the absence of question marks | 19:33 |
| fenn | swimming lets you burn more energy simply because the increased cooling prevents heat-induced muscle fatigue | 19:33 |
| fenn | you can "sprint" for much longer in water than on land | 19:33 |
| jrayhawk_ | if your metabolism doesn't upregulate in response to cold, most of your body shuts down pretty fast | 19:34 |
| kanzure | i am not sure muscle heat is the limiting factor in sprinting? | 19:34 |
| jrayhawk_ | it's just a question of which metabolic processes are used to generate entropy | 19:34 |
| jrayhawk_ | in this case BAT uses decoupled oxphos, which is extremely efficient but low throughput, and shivering uses glycolysis, which is extremely inefficient but high-throughput | 19:35 |
| jrayhawk_ | and, more importantly, mammals *hate* shivering | 19:36 |
| kragen | what do you mean by 'inefficient' | 19:36 |
| jrayhawk_ | inefficient from the perspective of cellular and mitochondrial respiration | 19:37 |
| kragen | like you only convert 50 percent of the chemical energy into heat and the other 50 percent gets transformed into radio waves or something | 19:37 |
| fenn | dark energy | 19:37 |
| kragen | i mean i understand if we are talking about producing atp from stuff but we are talking about warming up your body, aren't we | 19:38 |
| fenn | it's also found in dark chocolate | 19:38 |
| kanzure | dark energy http://img2.wikia.nocookie.net/__cb20110427010421/yuyuhakusho/images/thumb/b/b4/Hiei_Darkness_Flame_Ep30.jpg/500px-Hiei_Darkness_Flame_Ep30.jpg | 19:38 |
| jrayhawk_ | oxidative phosphorylation doesn't happen in a vacuum | 19:39 |
| fenn | yes it needs oxygen | 19:39 |
| kragen | or as a great american said recently, 'i can't breathe. i can't breathe. i can't breathe' | 19:40 |
| kragen | seriously though | 19:40 |
| jrayhawk_ | turns out you don't need to breath nearly as much when the mammalian dive reflex kicks in | 19:41 |
| kragen | it seems to me like metabolic processes are going to be a rounding error away from 100 percent efficient when we're evaluating them as means of producing heat | 19:41 |
| fenn | maybe he means "with less deleterious side effects" | 19:42 |
| kragen | except for, like, photosynthesis, or if you look at just one part of oxphos or the krebs cycle or whatever, a part where you still have output products with substantial energy left in them | 19:42 |
| jrayhawk_ | efficiency can refer to inputs as well as outputs | 19:42 |
| kragen | oh, that could be. is that what you mean, jrayhawk_ | 19:42 |
| fenn | sugar is scarce in eskimo-land so fat-burning conserves sugar? | 19:43 |
| jrayhawk_ | i don't really care enough to explain things to you; as near as i can tell you look up none of the words you don't understand and just start inferring in insane directions | 19:43 |
| jrayhawk_ | so telling you more words you don't understand just makes things worse | 19:43 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Remote host closed the connection] | 19:45 | |
| kanzure | maybe paperbot should also track tagged bookmarks for papers | 19:47 |
| kanzure | dump straight into jotmuch, even | 19:48 |
| kanzure | also, i am not sure why paperbot has been failing lately, i assume software reasons | 19:48 |
| fenn | it's a simple matter of programming | 19:49 |
| fenn | not enough codes | 19:49 |
| kanzure | right | 19:49 |
| kanzure | although maybe some of the user agent strings have been blockened | 19:50 |
| kanzure | i would expect more .txt links in that case | 19:50 |
| kanzure | and .txt links have not been happening for a while now | 19:50 |
| jrayhawk_ | volume on paperbot links is pretty low; you could just start logging *everything* | 19:51 |
| kanzure | i have been logging everything | 19:51 |
| jrayhawk_ | oh good; where do those wind up | 19:51 |
| kanzure | #paperbot-testing | 19:51 |
| jrayhawk_ | fancy | 19:52 |
| kanzure | might be more productive to just focus on paperbot v2 | 19:52 |
| kanzure | since it's less of a shitpile | 19:52 |
| kragen | jrayhawk_: no, i did in fact look up a bunch of things in order to clarify your earlier remarks about lipopolysaccharides. it's just that what you were saying just now didn't make any sense | 19:53 |
| kanzure | https://github.com/kanzure/paperbot/tree/master/paperbot | 19:53 |
| fenn | pyruvate, the byproduct of glycolysis, is oxidized in the citric acid cycle, so in the end all the energy is released regardless which pathway you use | 19:54 |
| kragen | but i don't think the problem is that it didn't make any sense -to me-, although i didn't come out and say that at the time because that would be rude | 19:54 |
| kragen | however, clearly it was a mistake to attempt to extend courtesy to you, since you interpreted courtesy as weakness and an invitation to attack | 19:55 |
| kanzure | haha that was an attack? | 19:56 |
| jrayhawk_ | if that was an attack, i refuse to believe you have ever talked to kanzure | 19:56 |
| kragen | heh | 19:56 |
| jrayhawk_ | kanzure would've just been all "fuck you" because he's much better at this than me | 19:56 |
| kragen | you hvae a point | 19:56 |
| kragen | anyway, i've recalibrated now | 19:57 |
| kanzure | no what i would be worried about is an actual jrayhawk attack | 19:57 |
| kanzure | you'd be catatonic for a decade | 19:57 |
| kragen | heh | 19:57 |
| kragen | i'm sure i'll survive | 19:57 |
| kragen | i just won't bend over backwards to be polite any more | 19:57 |
| kanzure | that preggo didn't | 19:58 |
| jrayhawk_ | that's good | 19:58 |
| kanzure | i like this place | 19:59 |
| fenn | in engineering there are different kinds of efficiency: thermodynamic efficiency, combustion efficiency, volumetric efficiency... it's unclear (to me at least) which one jrayhawk meant, if any of these | 20:00 |
| jrayhawk_ | i am really not interested in writing a three hour lecture on the limits imposed by mitochondrial respiration | 20:00 |
| jrayhawk_ | you guys get to look that up | 20:00 |
| kragen | i think you were just saying something incoherent and you're embarrassed to admit it | 20:01 |
| kragen | it's going to be okay | 20:01 |
| fenn | one problem is that most biology texts assume you start with glucose, not fatty acids | 20:02 |
| kragen | it's not actually a big deal | 20:02 |
| jrayhawk_ | though i was referring strictly to efficient use of inputs, fenn's 'side effects' are also a valuable and important inference | 20:02 |
| jrayhawk_ | or, rather, that one input | 20:04 |
| fenn | which input? | 20:05 |
| jrayhawk_ | oxygen | 20:05 |
| fenn | now i am really confused | 20:05 |
| kanzure | shivering, oxygen, dive reflex, keep track come on | 20:06 |
| fenn | i had never heard of the dive reflex before a few hours ago | 20:06 |
| -!- Vutral [~ss@mirbsd/special/Vutral] has quit [Excess Flood] | 20:06 | |
| -!- Vutral [~ss@mirbsd/special/Vutral] has joined ##hplusroadmap | 20:06 | |
| fenn | bradycardia and peripheral vasoconstriction don't seem to be what happens in healthy people exposed to cold | 20:08 |
| fenn | you would quickly get frostbite | 20:09 |
| kragen | it depends on how much cold | 20:09 |
| kragen | there's a thing called the hunter's reflex | 20:09 |
| kragen | it took me a few months of south dakota winter before it started to activate | 20:09 |
| kragen | but yeah, peripheral vasoconstriction is in fact one of the first responses in a healthy person exposed tocold | 20:10 |
| kragen | to cold | 20:10 |
| fenn | i guess this is "hunting" like the way a thermostat hunts for the setpoint by turning the heat on and off | 20:11 |
| kragen | no, it's 'hunting' like 'squatting behind a blind waiting for your prey to appear' | 20:11 |
| kragen | although it does oscillate | 20:12 |
| jrayhawk_ | re: paperbot v2: but rewrites killed netscape and wordstar! do you seriously think you can out-program billion-dollar compa- | 20:13 |
| jrayhawk_ | oh wait, it's kanzure, nevermind | 20:13 |
| kragen | also paperbot is less functionality in orders of magnitude more memory and cpu than wordstar | 20:13 |
| kragen | which is not a criticism | 20:13 |
| jrayhawk_ | yeah, i can't make that joke work properly | 20:14 |
| jrayhawk_ | it requires a mix of obliviousness and acuity | 20:14 |
| kragen | yeah | 20:14 |
| kragen | only an insane person would think they had to, say, write an http daemon that fits in two kilobytes of i386 code | 20:14 |
| fenn | they're called "alpha males" because they're crude and not ready for the public | 20:14 |
| jrayhawk_ | i should've relied on kanzure to straightman it | 20:14 |
| kanzure | honestly i sort of forget whether or not paperbot actually worked in the first place | 20:14 |
| kanzure | like, everything being unavailable is sort of not unexpected | 20:15 |
| kanzure | so i am having trouble estimating my surprisal about failures these days | 20:15 |
| kanzure | oh right, nmz787 fetches the paper sometimes | 20:15 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 20:15 | |
| kanzure | so therefore paperbot is breaking somewhere | 20:16 |
| kanzure | fwiw i think lkcl legitimately believes that he could handle a webkit rewrite | 20:18 |
| kragen | that sounds like a productive thing for him to do | 20:21 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Ping timeout: 245 seconds] | 20:22 | |
| kanzure | well, servo might be more productive these days | 20:22 |
| jrayhawk_ | what's wrong with webkit that would actually be served by a rewrite | 20:22 |
| kragen | webkit uses an order of magnitude more ram than simpler html rendering engines like the ones in dillo and elinks | 20:26 |
| jrayhawk_ | it also supports orders of magnitude more features | 20:26 |
| kragen | it would be nice if that were true | 20:27 |
| kragen | it does support some more features | 20:27 |
| jrayhawk_ | javascript, css, XSLT, etc. | 20:27 |
| jrayhawk_ | Sure would be nice if any webkit browsers supported disabling CSS. | 20:27 |
| kragen | it doesn't support javascript; that's a separate thing | 20:27 |
| kragen | dillo and elinks do support css, to some extent | 20:28 |
| jrayhawk_ | and elinks soooortof sometimes supports js | 20:28 |
| kragen | yeah but you wouldn't have to rewrite v8 or nitro to rewrite webkit | 20:28 |
| jrayhawk_ | wait, how does elinks support css | 20:28 |
| kragen | you could use them with your new engine | 20:28 |
| kragen | very poorly | 20:28 |
| kragen | i don't know anything about how webkit supports xslt | 20:29 |
| jrayhawk_ | like, what is a css feature that elinks supports | 20:29 |
| -!- poppingtonic [~poppingto@unaffiliated/poppingtonic] has quit [Ping timeout: 245 seconds] | 20:29 | |
| kragen | font color iirc | 20:29 |
| jrayhawk_ | " If you have use of background colors enabled more pages will have the intended background color. Also quite a few additional text attributes are applied. One example is highlighting of search words on Google's cached pages." | 20:29 |
| jrayhawk_ | oh man, i hope they support blinks and marquees | 20:29 |
| jrayhawk_ | that'd be great | 20:30 |
| kragen | haha | 20:30 |
| jrayhawk_ | oh, and multimedia, i suppose | 20:31 |
| kragen | anyway webkit is sort of spectacularly inefficient compared to the platonic ideal html parser | 20:31 |
| kragen | so it would be nice if we could get xslt for the pages that use it without making every page take up megabytes of dom memory | 20:32 |
| kragen | but frankly i don't think it's going to happen because if it was going to happen it would have happened in 2000 or 2001 | 20:32 |
| kragen | when it was legitimately a pain that mozilla was using a hundred megs of ram | 20:33 |
| fenn | jrayhawk_: just use sudo display: inline !important | 20:33 |
| fenn | i was going to say "but you can just override malicious CSS" but that's not quite true | 20:34 |
| kragen | display: inline !shibboleet !important !please | 20:34 |
| fenn | such style | 20:35 |
| kragen | i can't be the only person who consistently reads '!important' as 'not important' | 20:35 |
| kragen | and i think that anything other than, say, security or performance could be attacked more effectively by adding code to webkit than by rewriting it | 20:36 |
| kragen | but lkcl should have something to do that doesn't consist of pissing people off | 20:37 |
| kragen | writing a new browser engine sounds perfect | 20:37 |
| kragen | as long as nobody uses it | 20:37 |
| jrayhawk_ | what are some other kitchen sink specifications that nobody can agree on what the safe and prudent subsets to implement are? there's c++, for which the bloated GNU implementation got replaced by clang reasonably effectively... | 20:42 |
| fenn | perl, apparently | 20:43 |
| fenn | jrayhawk_: this list will probably go on gaining in size faster than we can enumerate it | 20:43 |
| jrayhawk_ | perl5 would be disastrous to call a specification, and perl6 never got finalized | 20:44 |
| -!- cluckj [~cluckj@cpe-24-92-48-18.nycap.res.rr.com] has quit [Quit: Leaving] | 20:44 | |
| jrayhawk_ | though i guess pugs was pretty efficient insofar as these things go | 20:44 |
| fenn | parrot was probably worth something | 20:45 |
| jrayhawk_ | would've been had llvm not come along with a BSD license | 20:45 |
| fenn | right | 20:45 |
| kanzure | people who get pissed off of at lkcl are just ignorant | 20:51 |
| fenn | so i am interested in using "mobile" GPU like mali450 to do GPGPU, anyone know about the state of things or what to look into? | 20:53 |
| -!- Beatzebub [~beatzebub@d172-218-204-36.bchsia.telus.net] has joined ##hplusroadmap | 20:53 | |
| fenn | these are found in ARM SoC like every cellphone | 20:54 |
| * fenn looks at http://limadriver.org/Compiler/ | 20:55 | |
| kragen | clang replacing gcc is a matter of apple feeling a life-or-death fear of the gplv3 | 20:56 |
| kragen | fenn: i made some notes about mail450 gpgpu recentl | 20:56 |
| fenn | i am trying to do computer vision, OCR, maybe SDR stuff | 20:57 |
| kragen | https://news.ycombinator.com/item?id=8750592 are my notes on gpgpu on the odroid-c1 | 20:57 |
| kanzure | "None of those stories have to do with a fault of Bitcoin, but rather bad 3rd party company practices. Unlike a breach of the Home Depot website, which strikes at the core of USD's credibility." | 20:58 |
| fenn | kanzure: credit card, not USD | 20:58 |
| kragen | kanzure: that is hilarious | 20:59 |
| kanzure | credit card denominated USD | 20:59 |
| fenn | bank bailout is USD | 20:59 |
| kanzure | nah that was treasury bond interest rate swaps | 20:59 |
| kragen | the odroid-c1 does use a mali-450 mp2, so this is relevant | 20:59 |
| kanzure | or some shit | 20:59 |
| fenn | kragen: yes the odroid uses the same cpu family as my new toy | 21:00 |
| kragen | hopefully my notes there are relevant | 21:01 |
| kragen | let me know if you find anything else related | 21:01 |
| fenn | thank you, i will read this and get back to you | 21:01 |
| fenn | i dont remember why i passed up the odroid-c1 | 21:02 |
| kragen | it looks pretty appealing | 21:03 |
| fenn | i think i wanted more ram | 21:05 |
| fenn | but for $35 holy bejeezus that's a lot of stuff | 21:05 |
| kanzure | why is there still no open source baseband chip? | 21:07 |
| fenn | what is a baseband chip | 21:07 |
| kanzure | has nobody written a good (available) protocol to implement? | 21:07 |
| kanzure | .wik baseband processor | 21:07 |
| yoleaux | "A baseband processor (also known as baseband radio processor, BP, or BBP) is a device (a chip or part of a chip) in a network interface that manages all the radio functions (all functions that require an antenna). This may not include Wi-Fi and/or Bluetooth. A baseband processor typically uses its own RAM and firmware." — http://en.wikipedia.org/wiki/Baseband_processor | 21:07 |
| fenn | (technical note: baseband refers to transmissions from 0Hz on up, usually used in copper wire networking equipment such as ethernet i.e. 10BASE-T) | 21:08 |
| kanzure | is an fpga implementation too slow? | 21:09 |
| fenn | no | 21:09 |
| fenn | it's probably not even desirable | 21:09 |
| kanzure | maybe nobody has access to a well documented antenna interface? | 21:09 |
| fenn | is this the same thing or is it the other end? http://openbts.org/hardware/ | 21:10 |
| kanzure | hrm, you know, i can't tel | 21:11 |
| kanzure | *tell | 21:11 |
| fenn | i think it's the tower hardware | 21:12 |
| kanzure | that may just be a form factor issue only | 21:12 |
| fenn | so i have no idea why there isn't an equivalent mobile transciever project | 21:12 |
| fenn | tower does a lot more stuff than the phone | 21:12 |
| kanzure | true.. but phone might just be restricted because shitty engineering decisions.. | 21:13 |
| kanzure | like, there are strict power constraints, sure, but your phone is not always mobile anyway | 21:13 |
| fenn | yes it's very master-slave relationship | 21:13 |
| fenn | like the tower says jump, phone asks how high? | 21:13 |
| kanzure | right, and i don't think that's necessary (other than physical constraints) | 21:13 |
| fenn | it's not necessary and a gaping huge security hole that aliens can teleport through | 21:14 |
| fenn | like in howard the duck | 21:14 |
| kanzure | so therefore a tower thing might be sufficient | 21:14 |
| kanzure | and perhaps nobody has compressed the form factor yet | 21:14 |
| kanzure | but this seems a little absurd to me | 21:14 |
| fenn | i'm saying the protocol is bad | 21:14 |
| kanzure | surely they have a protocol in here that they baked in? | 21:14 |
| * kanzure warily clicks "documentation" | 21:15 | |
| kanzure | http://openbts.org/site/wp-content/uploads/2014/07/OpenBTS-4.0-Manual.pdf | 21:15 |
| fenn | there is so much horrible telephony stuff that just needs to go away forever | 21:16 |
| kanzure | "OpenBTS Implementation of GSM & 3GPP Specifications and IETF Standards" | 21:16 |
| kanzure | what's the ietf stuff? | 21:16 |
| kanzure | RFC-3428 | 21:17 |
| kanzure | huh so maybe this project really has no soul | 21:17 |
| kanzure | wtf? | 21:17 |
| fenn | it's just an open hardware implementation of the tower protocol | 21:17 |
| fenn | SIP has nothing to do with it afaict | 21:18 |
| fenn | aside from routing the packets | 21:18 |
| kanzure | hrm so okay, at minimum there is no obvious good cell2cell tower2cell protocol | 21:20 |
| kanzure | and then on top of that, form factor hardware issues for cell phones | 21:20 |
| fenn | oh i see, i think it can translate from VoIP to POTS via Asterix | 21:21 |
| fenn | asterisk | 21:21 |
| kanzure | hehe match the evolution of the actual telecom industry i guess? | 21:21 |
| kanzure | that's probably the only way to understand all the bad decisions i suppose | 21:22 |
| fenn | there is no phone to phone protocol(?) | 21:22 |
| kanzure | "why am i on the same subnet as hong kong?" | 21:22 |
| -!- Viper168 [~Viper@unaffiliated/viper168] has quit [Ping timeout: 256 seconds] | 21:22 | |
| fenn | there's no "ad hoc mode" for GSM | 21:22 |
| fenn | phones are rather shitty radios, the tower does all the hard work | 21:24 |
| kanzure | i think phones are better transceivers when you are okay with high latency and waiting 10 hours until someone plugs them | 21:24 |
| kanzure | *them in | 21:24 |
| kragen | 05:13 < kanzure> right, and i don't think that's necessary (other than physical constraints) | 21:25 |
| kragen | no, it's clearly not necessary, but it does simplify some things a lot | 21:25 |
| fenn | serval mesh is trying to do something like VoIP telephony over a mesh network of mobile phones... | 21:26 |
| fenn | but it uses wifi, not gsm | 21:26 |
| kanzure | emphasis on real-time really bothers me | 21:27 |
| fenn | about phones in general? or the baseband processor stuff | 21:27 |
| kanzure | they need to relax and allow for any implementation to happen at all | 21:27 |
| kanzure | nah mesh network stuff | 21:27 |
| kanzure | like voice over ip stuff as v0 demos for mesh networking | 21:27 |
| kragen | real-time is really important for mesh networking | 21:27 |
| kanzure | by which i think they mean two-way voice | 21:27 |
| kragen | oh | 21:28 |
| kragen | you mean real-time applications of the network | 21:28 |
| kanzure | right | 21:28 |
| kragen | not real-time software to run the baseband | 21:28 |
| kanzure | i don't even know what the constraints of the undesigned network are yet, so adding application constraints is crazy | 21:28 |
| fenn | yes latency is an important characteristic of routers, regardless of application | 21:28 |
| kragen | yeah, what i mean is that meeting low-latency constraints becomes much more challenging in a mesh network world | 21:29 |
| kragen | it's really hard to do cut-through wormhole routing when your received signal is 100 db quieter than your transmitted signal | 21:29 |
| kragen | and in the same medium | 21:30 |
| fenn | obviously a single fiber has better latency than many hops with pauses at each hop to verify and retransmit bad packets | 21:30 |
| -!- Viper168 [~Viper@unaffiliated/viper168] has joined ##hplusroadmap | 21:30 | |
| kragen | even if you eliminate the verify-and-retransmit nonsense | 21:31 |
| fenn | hrm i guess TCP just drops packets anyway | 21:31 |
| kragen | multihop radio networks do typically do hop-by-hop retransmission in order to get acceptable packet loss rates | 21:31 |
| kragen | but you could presumably use turbo codes or some nonsense instead | 21:32 |
| -!- augur_ is now known as augur | 21:33 | |
| fenn | you must use the proper noun "le Turbo Code" | 21:34 |
| delinquentme | fenn, capitalization plz | 21:34 |
| delinquentme | "~Le~ Turbo Code" | 21:35 |
| delinquentme | IM EATING COOKIES MOFUGGRS | 21:35 |
| fenn | party woo | 21:35 |
| jrayhawk_ | actually that dogged insistence on applying "thermal" to all instances of the word "efficiency" raises an interesting point: are there any biological systems doing >100% heating efficiency? | 21:36 |
| jrayhawk_ | seems conceptually simple, but i can't think of any | 21:36 |
| fenn | lizards | 21:36 |
| fenn | no wait | 21:36 |
| * delinquentme dances | 21:37 | |
| delinquentme | also akira | 21:37 |
| kanzure | delinquentme: https://www.youtube.com/watch?v=Yl9GGiwtD98&index=49&list=FL1sapBsRQ1__rgp7qWs0cow | 21:38 |
| fenn | i can't think of any.. most life is cold-blooded anyway | 21:38 |
| delinquentme | hmmmmmmm! | 21:39 |
| fenn | there is probably some sea creature that derives energy from the thermal layer near the ocean surface | 21:39 |
| fenn | but that's the opposite | 21:39 |
| fenn | like the drinking bird physics toy | 21:40 |
| jrayhawk_ | i would expect some extremophile mammal to do it reversibly | 21:41 |
| jrayhawk_ | like a camel or something | 21:41 |
| jrayhawk_ | but i guess it's just too big a genetic leap | 21:41 |
| fenn | water vapor condensation is some kind of heat pump | 21:42 |
| jrayhawk_ | Yeah, at least we got that going for us. | 21:42 |
| delinquentme | kanzure, youve seen spriggan ja? | 21:42 |
| delinquentme | fenn, you just cant explain that | 21:43 |
| fenn | there are chilean beetles that collect water vapor on their backs, so heat necessarily flows into the shell | 21:43 |
| fenn | desert beetles | 21:43 |
| fenn | and of course lots of plants collect dew | 21:44 |
| jrayhawk_ | http://www.ncbi.nlm.nih.gov/pubmed/12786594 | 21:44 |
| jrayhawk_ | fascinating | 21:44 |
| fenn | by golly | 21:45 |
| fenn | .title | 21:45 |
| yoleaux | Natural thermoelectric heat pump in social wasps. - PubMed - NCBI | 21:45 |
| jrayhawk_ | still cooling rather than heating, but that's pretty goddamned whizbang amazing | 21:45 |
| fenn | http://fennetic.net/irc/hornet_thermoelectric_cooling.pdf | 21:47 |
| kanzure | "Electronic address: physio7@post.tau.ac.il" | 21:48 |
| fenn | if it's a heat pump there should be a part of the hornet that is hotter than ambient as well | 21:49 |
| kanzure | "web electron receptable street address" | 21:49 |
| kanzure | *receptacle | 21:49 |
| fenn | vs just water evaporation | 21:49 |
| kanzure | let's steal that part | 21:50 |
| fenn | oh its thorax is actually warmer (and the abdomen is colder) in figure 1 c | 21:50 |
| fenn | that could be heat from the exertion of flying | 21:52 |
| kanzure | jrayhawk did you see the ecoli fatty acid synthesis stuff | 21:52 |
| jrayhawk_ | Don't think so. | 21:53 |
| kanzure | "glyoxylate shunt to introduce fatty acid metabolism to human liver cells, to convert fat into glucose" http://2013.igem.org/Team:Hong_Kong_HKUST/Project | 21:53 |
| fenn | that wasn't it | 21:54 |
| kanzure | "yeast production of unsaturated fatty acids, docasapentaenoic acid (DPA), docosahexaenoic acid (DHA)" http://2014.igem.org/Team:HUST-Innovators# | 21:54 |
| kanzure | "ecoli synthesis of fatty acids" http://2014.igem.org/Team:NJU-QIBEBT/team/Overview | 21:54 |
| fenn | http://2014.igem.org/Team:HUST-Innovators# yeast production of unsaturated fatty acids, docasapentaenoic acid (DPA), docosahexaenoic acid (DHA) | 21:54 |
| fenn | you might want to turn off css for this one | 21:55 |
| fenn | oh it looks ok in webkit | 21:56 |
| fenn | bah there is nothing there | 21:57 |
| fenn | "here is a screenshot of our sequence" | 21:58 |
| kanzure | er try another page maybe | 21:59 |
| -!- vi is now known as Qfwfq | 21:59 | |
| -!- Qfwfq [~WashIrvin@58.182.38.58] has quit [Changing host] | 22:00 | |
| -!- Qfwfq [~WashIrvin@unaffiliated/washirving] has joined ##hplusroadmap | 22:00 | |
| kanzure | we definitely need a better list of "metabolic stuff to fix" | 22:01 |
| kanzure | and "metabolism stuff to steal from other species" | 22:01 |
| kanzure | "also vitamin stuff" | 22:01 |
| fenn | i feel like i am using hypercard | 22:02 |
| kanzure | but really it's mediawiki | 22:03 |
| fenn | how did they fuck up a mediawiki page so badly | 22:03 |
| kanzure | everything on igem.org is mediawiki | 22:03 |
| fenn | i mean you have to work to make something this bad | 22:03 |
| -!- qu-bit [~shroedngr@unaffiliated/barriers] has joined ##hplusroadmap | 22:04 | |
| kanzure | they give out prizes for "best website" | 22:04 |
| fenn | ugh | 22:04 |
| kanzure | so they have an incentive to make shitty websites | 22:04 |
| fenn | they should give out prizes for actually fucking finishing your project | 22:04 |
| kanzure | i think they have that, it went to the bioart team | 22:05 |
| fenn | http://parts.igem.org/Part:BBa_K1551000 apparently this thing is the result of their project | 22:06 |
| kanzure | .title | 22:07 |
| yoleaux | Part:BBa K1551000 - parts.igem.org | 22:07 |
| -!- qu-bit [~shroedngr@unaffiliated/barriers] has quit [Remote host closed the connection] | 22:07 | |
| fenn | "delta-4 fatty acid Desaturase so as to synthesize the DHA." | 22:08 |
| fenn | unclear exactly what is on the plasmid | 22:08 |
| fenn | also no sequence data? is igem always like this? | 22:08 |
| kanzure | my advisor gave me so many earfuls about how awful igem was heh | 22:09 |
| fenn | i guess "not released" means incomplete for some unspecified reason | 22:09 |
| fenn | how i wished this project ended: with HPLC traces of DPA and EPA, and a plasmid sequence | 22:11 |
| kanzure | i should make a "geocities or igem?" site | 22:13 |
| fenn | industrial conversion of flax oil to EPA+DHA would be really useful | 22:14 |
| kanzure | "area51 site or bored undergrads wasting their advisor's reagents?" | 22:14 |
| fenn | meh it's education, i just wish they weren't doing it on my time :P | 22:14 |
| fenn | i mean go ahead, make a website, but why the fuck does any igem team need to do web design at all | 22:15 |
| fenn | "Illegal BsaI site found at 1700 | 22:19 |
| fenn | seems to indicate that iGEM has an actual sequence on file | 22:19 |
| fenn | but they won't show it for some reason | 22:19 |
| kanzure | i would worry about correct/broken up/down regulation of implanted metabolism or synthesis | 22:20 |
| kanzure | maybe you could find something in human that is expressed similarly, or doubly more than enough, and use those promoters so that the expression of your other thing will be tied to those levels | 22:21 |
| fenn | aha it's hidden in some javascript thing | 22:22 |
| fenn | String('agacggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaactaatactttcaacattttcggtttgtattacttcttattcaaatgtaa | 22:23 |
| fenn | taaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacatgggcaagggcagcgagggccgcagcgcggcgcgcgagatgacggccgaggcgaacggcgacaagcggaaaacgattctgatcgagggcgtcctgtacgacgcgacgaactttaagcacccgggcggttcgatcatcaacttcttgaccgagggcgaggccggcgtggacgcgacgcaggcgtaccgcgagtttcatcagcggtccggcaaggccgacaagtacctcaagtcgctgccgaagctggatgcgtccaaggtggagtcgcggttctcggccaaagagcaggcgcggcgcgacgccatgacgcgcgactacgcggcctttcgcgaggagct | 22:23 |
| fenn | cgtcgccgaggggtactttgacccgtcgatcccgcacatgatttaccgcgtcgtggagatcgtggcgctcttcgcgctctcgttctggctcatgtccaaggcctcgcccacctcgctcgtgctgggcgtggtgatgaacggcattgcgcagggccgctgcggctgggtcatgcacgagatgggccacgggtcgttcacgggcgtcatctggctcgacgaccggatgtgcgagttcttctacggcgtcggctgcggcatgagcgggcactactggaagaaccagcacagcaagcaccacgccgcgcccaaccgcctcgagcacgatgtcgatctcaacacgctgcccctggtcgcctttaacgagcgcgtcgtgcgcaaggtcaagccgggatcgctgct | 22:23 |
| fenn | ggcgctctggctgcgcgtgcaggcgtacctctttgcgcccgtctcgtgcctgctcatcggccttggctggacgctctacctgcacccgcgctacatgctgcgcaccaagcggcacatggagttcgtctggatcttcgcgcgctacattggctggttctcgctcatgggcgctctcggctactcgccgggcacctcggtcgggatgtacctgtgctcgttcggcctcggctgcatttacattttcctacaattcgccgtcagccacacgcacctgccggtgaccaacccggaggaccagctgcactggctcgagtacgcggccgaccacacggtgaacattagcaccaagtcctggctcgtcacgtggtggatgtcgaacctgaactttcagatcgagca | 22:23 |
| fenn | ccacctcttccccacggcgccgcagttccgcttcaaggaaatcagtcctcgcgtcgaggccctcttcaagcgccacaacctcccgtactacgacctgccctacacgagcgcggtctcgaccacctttgccaatctttattccgtcggccactcggtcggcgccgacaccaagaagcaggactgaatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaa | 22:23 |
| fenn | ggttttgggacgctcgaaggctttaatttgcaagct'); | 22:23 |
| fenn | muwahahaha | 22:23 |
| fenn | ok i'm done now | 22:23 |
| delinquentme | fenn that new line caused a frameshift | 22:24 |
| delinquentme | now you've got a tail | 22:24 |
| fenn | did i paste a newline? | 22:24 |
| delinquentme | kanzure, of the people in this channel ... how many actually have said something in the past year? | 22:25 |
| delinquentme | any idea? | 22:25 |
| fenn | almost all of them | 22:25 |
| delinquentme | fenn, numbers plz | 22:26 |
| fenn | dunno who these people are: altersid_ kenju254 crescendo dvorkbjel nArkos_ night | 22:26 |
| delinquentme | HEx2, | 22:27 |
| delinquentme | comma8, | 22:27 |
| delinquentme | sivoais, | 22:28 |
| comma8 | hi | 22:28 |
| comma8 | I dunno how I got here | 22:28 |
| sivoais | 10101010101101 | 22:28 |
| sivoais | wait, are we asking for numbers now? | 22:29 |
| fenn | http://hexwab.plus.com/~HEx/ looks pretty hackerly | 22:29 |
| delinquentme | people are alivveee | 22:31 |
| fenn | .tw https://twitter.com/hmason/status/520367337925390337 | 22:32 |
| yoleaux | TIL that the phrase software "patch" is from a physical patch applied to Mark 1 paper tape to modify the program. http://t.co/v8iVq6Hjar (@hmason) | 22:32 |
| fenn | "By designing interlocking blocks, the need for mortar (the white compound between bricks to hold them in place) is eliminated." not really sure how this works http://kenju254.blogspot.com/2012/07/interlocking-stabilised-soil-blocks.html | 22:45 |
| -!- Boscop [me@unaffiliated/boscop] has joined ##hplusroadmap | 22:45 | |
| maaku | fenn: worked in japanese construction for thousands of years | 22:48 |
| fenn | japanese joinery is pretty intricate | 22:49 |
| fenn | these just look like roughly rectangular wedges | 22:49 |
| fenn | oh it's like tongue and groove flooring: http://www.volumization.com/images/Block_Making/STEP6.jpg | 22:50 |
| kragen | jrayhawk_: i don't think there are any biological heat pumps, no | 22:51 |
| fenn | kragen what's your opinion on http://fennetic.net/irc/hornet_thermoelectric_cooling.pdf | 22:52 |
| kragen | to heat things up i mean | 22:52 |
| kragen | my opinion is that i didn't know about that previously and it will be awesome to find out if it is actually happening | 22:54 |
| fenn | their argument is basically "it can't be water evaporation because insects have waxy impermeable coatings" | 22:54 |
| -!- Evoril [~Evoril@86-45-222-8-dynamic.agg2.crw.prp-wtd.eircom.net] has joined ##hplusroadmap | 22:56 | |
| -!- qu-bit [~shroedngr@unaffiliated/barriers] has joined ##hplusroadmap | 22:57 | |
| fenn | citations should always include the title of the cited paper | 22:57 |
| fenn | paperbot: sciencedirect.com/science/article/pii/002219109290020E | 22:59 |
| fenn | .title http://phys.org/news/2011-01-physicists-outer-shell-hornet-harvest.html | 23:02 |
| yoleaux | Physicists discover how the outer shell of a hornet can harvest solar power | 23:02 |
| delinquentme | HEHEHEH | 23:04 |
| delinquentme | Paddy hat | 23:04 |
| fenn | http://fennetic.net/irc/hornet_photovoltaic.pdf | 23:04 |
| fenn | 100mV from 360nm light is not the best solar cell ever | 23:06 |
| fenn | woah Ochiai is a real scientist | 23:08 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 23:09 | |
| kragen | heh | 23:10 |
| kragen | biological systems are optimized, even within their reachable envelope, for resilience rather than efficiency | 23:11 |
| * fenn mumbles about dancing bears | 23:13 | |
| fenn | oh that was from a different universe. "The amazing thing about the dancing bear is not how well it dances, but that it dances at all." | 23:15 |
| delinquentme | know what fixes that bear? | 23:16 |
| delinquentme | captivity and whips | 23:16 |
| delinquentme | MURIKA | 23:16 |
| delinquentme | maybe time to cut back on the cookies | 23:17 |
| fenn | since the hornet's photovoltaic effect only occurs between 360-380nm it's not just an accidental physical phenomenon like the photoelectric effect in metals | 23:22 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has quit [Remote host closed the connection] | 23:23 | |
| kragen | they said that was the peak quantum efficiency | 23:24 |
| fenn | the wavelength vs efficiency curve looks like a black body radiation distribution | 23:24 |
| fenn | i dont know what that implies | 23:24 |
| kragen | i don't either | 23:24 |
| kragen | perhaps that there is some distribution of bandgaps, so it's not perfectly sharp, but energy beyond that needed for the bandgap just becomes heat | 23:25 |
| kragen | but it seems like we're talking about a fairly tiny efficiency anyway | 23:26 |
| kragen | still, it might be the lowest-cost photovoltaic material per watt, depending on how cheaply you can fabricate things like copper oxides ;) | 23:26 |
| fenn | the photovoltaic effect is probably a side effect of its actual function as a heat pump | 23:27 |
| fenn | solid state heat pumps are stacked semiconductors; the top layer of semiconductor, when exposed to light, would generate a voltage | 23:28 |
| kragen | ahhh | 23:28 |
| kragen | that makes a lot of sense | 23:28 |
| fenn | but when a voltage is applied across the entire stack, the whole stack moves heat around | 23:28 |
| kragen | rght | 23:29 |
| kragen | right | 23:29 |
| fenn | in the other paper they are trying to show the stacked structure in electron micrographs, but it's somewhat of a stretch. extraordinary claims require extraordinary evidence and all that | 23:29 |
| fenn | there are about 30 layers so it would require at least 3V from the hornet in operation | 23:31 |
| fenn | insects often use this sort of layered structure to generate colors, like dichroics | 23:32 |
| -!- ebowden [~ebowden@CPE-124-187-233-85.lns2.dav.bigpond.net.au] has joined ##hplusroadmap | 23:32 | |
| fenn | it would be interesting if they also used it as camouflage from heat-sensing predators | 23:33 |
| kragen | 3v is doable with metals | 23:37 |
| kragen | but i guess the usual approach is like a capacitor ladder | 23:37 |
| kragen | like in an electric eel | 23:38 |
| nmz787 | fenn can you at least give me a bit of an explanation of what else I'd need to finish that parts list for the laser etcher? I'd like to order parts soon. | 23:43 |
| fenn | hmm. well looking at the rendering it still needs a screw, nut, bearing and bracket, stepper motors, coupler between stepper and screw, anti-backlash mechanism or just a spring, and a work table to mount the part you're etching upon | 23:47 |
| fenn | also maybe a bellvue washer/spring to take out slop in the bearings | 23:48 |
| fenn | you want to mount two opposed angle bearings on the same end of the screw, and another radial bearing on the other end of the screw so it doesn't whip around | 23:49 |
| fenn | i'm pretty sure i wrote this down in the wiki/repository somewhere | 23:49 |
| fenn | oh yes the nut mount flexure was a cute finishing touch | 23:50 |
| fenn | heh cody daniel http://www.mad-engineer.com/engineering/pet-projects/3-axis-cnc-mill/attachment/sony-dsc-9/ | 23:51 |
| fenn | stupid universe implosion | 23:51 |
| ebowden | +ping | 23:52 |
| fenn | "thanks for supporting the 1 mile clock" you're welcome | 23:53 |
| maaku | kanzure: I asked about kinematic replicators earlier because i think there's a viable business opportunity there in off-world resource extraction | 23:57 |
| maaku | principally on the moon and near-earth asteroids | 23:57 |
| fenn | once you're at that point, commerce ceases to be important | 23:57 |
| fenn | there's only resources, strategy, and knowledge | 23:58 |
| maaku | automated in-situ self-replicating manufacturing capability, even if it generates low-quality materials, can be instrumental in building infrastracture to support extraction of more profitable resources | 23:58 |
| maaku | fenn: eh, prices won't go to zero | 23:58 |
| maaku | i'm thinking more along the lines of sintering regolith to produce roads, warehouses, buildings, etc. | 23:59 |
| fenn | you've read freitas right? | 23:59 |
| maaku | yes | 23:59 |
| --- Log closed Tue Dec 30 00:00:03 2014 | ||
Generated by irclog2html.py 2.15.0.dev0 by Marius Gedminas - find it at mg.pov.lt!
