--- Day changed Mon Sep 14 2009 | ||
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [] | 01:19 | |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap | 01:21 | |
-!- genehacker2 [i=genehack@128.62.34.238] has quit [Read error: 145 (Connection timed out)] | 01:59 | |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 110 (Connection timed out)] | 04:09 | |
-!- Phreedom_ [n=quassel@195.216.211.175] has joined #hplusroadmap | 05:19 | |
-!- Phreedom [n=quassel@195.216.211.175] has quit [Read error: 104 (Connection reset by peer)] | 05:19 | |
-!- Phreedom_ [n=quassel@195.216.211.175] has quit [Read error: 113 (No route to host)] | 05:40 | |
-!- Phreedom [n=quassel@195.216.211.175] has joined #hplusroadmap | 06:04 | |
-!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: davidnunez__ | 07:09 | |
-!- Netsplit over, joins: davidnunez__ | 07:11 | |
-!- genehacker [i=genehack@wireless-128-62-180-131.public.utexas.edu] has joined #hplusroadmap | 07:55 | |
-!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: davidnunez__ | 08:00 | |
kanzure | fenn: why is paul smashing together revision control into his pointrel project? | 08:01 |
---|---|---|
kanzure | it seems like he's munging a lot of different things together needlessly | 08:01 |
-!- Netsplit over, joins: davidnunez__ | 08:01 | |
fenn | "I'm curious if your local robotics group is in a frenzy? Things from the virtual end look as if they are really kickn in that area." | 08:03 |
fenn | hmm how do people get these flawed perceptions i wonder | 08:03 |
kanzure | maybe he meant "kickin the bucket" | 08:04 |
kanzure | that would be closer to the truth | 08:04 |
fenn | zero status updates or evidence of activity for 5 months == really kickn | 08:04 |
kanzure | pay me $100,000 | 08:05 |
fenn | it's called "investment" | 08:10 |
-!- genehacker [i=genehack@wireless-128-62-180-131.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 08:19 | |
kanzure | fenn: did we ever test Point(TopoDS_Vertex()) ? | 08:42 |
kanzure | the other day i was doing TopoDS_Vertex() -> Point for some reason | 08:47 |
kanzure | guess i didn't merge | 08:47 |
kanzure | Point(BRep_Tool.Pnt(TopoDS_Vertex())) | 08:47 |
kanzure | is there a way to do that with OCC_triple fenn? | 08:47 |
kanzure | oops, it was: Point(BRep_Tool().Pnt(TopoDS_Vertex())) | 08:48 |
kanzure | huh that leads to a segmentation fault | 08:48 |
kanzure | for the record I had the code in the make_point function in import_tools/surf.py | 08:53 |
fenn | TopoDS_Vertex() points to nothing, essentially, so when you try to do a cast, it accesses some random memory location. make sense? | 08:58 |
kanzure | yep | 08:59 |
kanzure | vertex is a TopoDS_Vertex | 09:02 |
kanzure | location = vertex.Location() | 09:02 |
kanzure | location.IsDifferent(location.__class__())==1 | 09:02 |
kanzure | (I do that because I don't have TopLoc_Location imported and i'm lazy) | 09:03 |
kanzure | but it's always 0 | 09:03 |
kanzure | so this tells me that these vertices aren't being given any values | 09:03 |
kanzure | ah guess I have to explore wires | 09:11 |
-!- genehacker [i=genehack@wireless-128-62-175-44.public.utexas.edu] has joined #hplusroadmap | 09:51 | |
-!- mason_l [n=x@202-89-188-136.static.dsl.amnet.net.au] has joined #hplusroadmap | 09:58 | |
-!- mason-l [n=x@202-89-188-136.static.dsl.amnet.net.au] has quit [Read error: 110 (Connection timed out)] | 10:02 | |
fenn | http://fabfi.fablab.af/stats.php | 10:03 |
kanzure | why can't you add two dictionaries together? | 10:06 |
kanzure | dictionary1.extend or dictionary1.append or dictionary1.add would be nice to have | 10:06 |
-!- mason_l is now known as mason-l | 10:10 | |
fenn | um, those methods exist | 10:10 |
kanzure | where? | 10:11 |
fenn | sorry it's called update | 10:11 |
kanzure | blah | 10:11 |
kanzure | how do you determine whether or not to overwrite the dictionary? | 10:12 |
kanzure | I mean, if there's a key conflict | 10:12 |
kanzure | I guess there's "setdefault" | 10:12 |
fenn | what's "setdefault"? | 10:16 |
fenn | i guess it's whether you do a.update(b) or b.update(a) | 10:17 |
fenn | "The dot option corresponds to attributed dot output, and is the default output format. " | 10:23 |
fenn | they add layout attributes to the existing dot file, hence "ATtributing" | 10:23 |
-!- genehacker [i=genehack@wireless-128-62-175-44.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 10:35 | |
-!- genehacker [i=genehack@128.62.34.238] has joined #hplusroadmap | 10:42 | |
-!- superkuh_ [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap | 10:53 | |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Read error: 110 (Connection timed out)] | 11:17 | |
fenn | hmm how did it become monday already | 11:25 |
kanzure | saturday ate friday and sunday looked the other way | 11:26 |
fenn | damn you sunday! | 11:26 |
-!- xp_prg [n=xp_prg3@c-67-188-6-132.hsd1.ca.comcast.net] has quit ["This computer has gone to sleep"] | 11:36 | |
genehacker | the arrow of time | 11:46 |
-!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has quit [] | 11:55 | |
kanzure | what's the control code for the windows newline '^M' ? | 11:55 |
kanzure | escape sequence, sorry | 11:55 |
kanzure | I guess it's \r | 11:55 |
genehacker | ??? | 11:55 |
genehacker | try sacrificing a goat | 11:55 |
genehacker | sometimes it works | 11:56 |
fenn | jesus hates you | 11:56 |
fenn | RTFM | 11:56 |
kanzure | on a related note, BRepTools_WireExplorer worked when it wasn't OOified, but now that it is, it's not? wtf? | 11:57 |
kanzure | explorer.More() is telling me there are no more points | 11:57 |
kanzure | but .. but.. | 11:58 |
genehacker | why are you using winblows anyway? | 11:58 |
kanzure | pythonOCC is written by windorks | 11:58 |
kanzure | so they save these stupid files without any newlines | 11:58 |
kanzure | so it's all on one line | 11:58 |
kanzure | had to do a regular expression to fix their shit | 11:58 |
kanzure | wonder if windows 7 fixes this. my guess is no. | 11:58 |
genehacker | windows 7 takes 20 hours to install | 11:59 |
-!- xp_prg [n=xp_prg3@99.2.31.217] has joined #hplusroadmap | 12:02 | |
kanzure | http://adl.serveftp.org/~bryan/screenshots/2009-09-14_brep_approximation.png | 12:06 |
kanzure | not quite, huh | 12:07 |
genehacker | what's that weird line? | 12:08 |
kanzure | the program takes in a mesh and converts it into a point cloud | 12:09 |
kanzure | in this case the mesh is a cube | 12:09 |
kanzure | the weird line is an attempt at a boundary representation | 12:09 |
kanzure | i'm doing something wrong (i know what it is) | 12:09 |
fenn | looks like one correct control point and a bunch of random control points | 12:13 |
kanzure | well i'm assuming the mesh is a single face | 12:13 |
fenn | maybe you shouldnt start out with a cube then :) | 12:14 |
kanzure | blasphemy! | 12:14 |
* kanzure throws a rancor at fenn | 12:14 | |
fenn | so fablab.af is no more? | 12:15 |
kanzure | works for me | 12:15 |
kanzure | check your /etc/hosts | 12:15 |
kanzure | did you set it to be me? | 12:15 |
fenn | http://blog.fablab.af/?paged=2 | 12:15 |
fenn | oh it moved | 12:15 |
fenn | nm | 12:15 |
kanzure | not a bad living arrangement: http://scripts.mit.edu/~emu/fab/wp-content/uploads/2009/08/beds.jpg | 12:16 |
kanzure | however the computer in the room is weird | 12:16 |
kanzure | guess they're all awake at the same time | 12:16 |
kanzure | and where'd they find matching bed spreads anyway? | 12:17 |
genehacker | the local market I guess | 12:18 |
kanzure | hah the email from the engineering library is funny | 12:19 |
kanzure | "The McKinney Engineering Library is hosting two special events on Thursday, September 17 to commemorate IEEE’s 125 Birthday!" | 12:19 |
kanzure | "Research Bites: 11:00 am- noon" | 12:19 |
-!- kardan_ [n=kardan@p54BE407B.dip.t-dialin.net] has joined #hplusroadmap | 12:19 | |
kanzure | "Get search tips and give product suggestions to IEEE representatives. " | 12:19 |
kanzure | "Free Pizza for the 1st 30 attendees. " | 12:19 |
kanzure | so give the ieee guy a great product idea | 12:19 |
kanzure | and get free pizza | 12:19 |
kanzure | got it | 12:19 |
kanzure | (not that your idea is useful anyway) | 12:20 |
kanzure | on second thought maybe it's worth at least two slices | 12:20 |
fenn | "look a BOM!" http://scripts.mit.edu/~emu/fab/wp-content/uploads/2009/07/dsc_8873.jpg | 12:21 |
fenn | the paper says "kenny and amy's shopbot install kit" | 12:21 |
kanzure | oh my god that's almost useful | 12:22 |
kanzure | "here's a picture of the tools you need" | 12:22 |
kanzure | "and a picture of a list" | 12:22 |
* kanzure asks amy sun | 12:23 | |
kanzure | bah she left | 12:24 |
-!- genehacker [i=genehack@128.62.34.238] has quit [Read error: 145 (Connection timed out)] | 12:30 | |
fenn | i am sort of wondering where the cad files (or whatever passes for CAD in fab-dom) for FabFi are | 12:30 |
kanzure | btw there's a fab-lab-gurus mailing list | 12:31 |
fenn | oh. 'download' | 12:32 |
kanzure | it's smari acting as an interface between some fablab runners he knows and openmanufacturing | 12:32 |
kanzure | (because apparently "they can't handle it") | 12:32 |
kanzure | (it, being the truth.) | 12:32 |
fenn | bleh? | 12:32 |
fenn | maybe "it" is the signal to noise ratio | 12:33 |
kanzure | that there are people with the ideas that are presented on om | 12:33 |
fenn | .png is a cad format? | 12:33 |
fenn | http://www.fablab.af/fabfi/download/reflectors/xsmall_0_220/1.png | 12:34 |
kanzure | it is for cutters :( | 12:34 |
fenn | no, it isn't | 12:34 |
fenn | i dont understand why they don't use SVG | 12:34 |
fenn | it was obviously exported to DXF from some other drawing program | 12:35 |
-!- kardan| [n=kardan@p54BE7A5F.dip.t-dialin.net] has quit [Read error: 110 (Connection timed out)] | 12:35 | |
fenn | i dont know if autotracing the png is a good idea or not | 12:36 |
fenn | god this DXF is terrible | 12:36 |
kanzure | kanzure: but that's just CAD file format conversion right? | 12:38 |
-!- dira [n=chatzill@86.99.40.183] has joined #hplusroadmap | 12:38 | |
kanzure | kanzure: that's not very useful | 12:38 |
kanzure | kanzure: how does a PNG capture constraints? | 12:39 |
kanzure | Amy: each pixel is meaningful, you just scale | 12:39 |
kanzure | Amy: it depends on the object | 12:39 |
kanzure | Amy: sometimes only a sepcific thing matters | 12:39 |
fenn | ask why she doesn't use SVG | 12:39 |
dira | hey there | 12:39 |
kanzure | fenn: that was back in march | 12:39 |
fenn | oh | 12:40 |
kanzure | she did mention SVG before i did though | 12:40 |
kanzure | though not why it's not the first suspect | 12:40 |
kanzure | oh yay she emailed me | 12:40 |
kanzure | fenn: ok fwd'd it to you | 12:41 |
fenn | actually it's sort of hard to tell who is doing what, despite them blogging constantly | 12:41 |
kanzure | "ps - important to have power drill, too" | 12:42 |
fenn | oh i don't really care about the shopbot install kit in particular | 12:42 |
fenn | i would like to make a package for FabFi assuming licensing is ok and files exist | 12:43 |
kanzure | all these photos from afghanistan from fablab.af are fun | 12:44 |
kanzure | but in the back of my mind i'm laughing, "we make bomb now yes?" | 12:44 |
fenn | i guess.. i was looking at post-flood destruction | 12:44 |
kanzure | http://fabfi.fablab.af/ | 12:44 |
kanzure | "we make BOM now yes?" | 12:45 |
kanzure | hehe | 12:45 |
fenn | i sort of wonder how the afghani are so clueless in the fab lab when their brothers are out there making IED's | 12:45 |
kanzure | probably has something to do with "being extreme" | 12:45 |
fenn | isn't there some sort of reverse tech transfer from the militants? or are they actually all just foreigner | 12:46 |
kanzure | like, if you don't think your extreme, you thus try less or something? | 12:46 |
fenn | i dont think it has anything to do with trying | 12:46 |
fenn | they have these shape charge thingies made from a machined cone of cast copper.. | 12:46 |
fenn | now, copper is rather difficult to machine, especially if you're in the middle of the frickin desert with no tools | 12:47 |
kanzure | you think IEDs are machined? | 12:47 |
kanzure | what's improvised about a machined IED? | 12:47 |
fenn | so i'm looking at these kids with fancy CNC machinery who don't know what a drill bit is and wondering where it all went wrong | 12:47 |
fenn | uh, i saw some webpage somewhere which i'll probably never find again | 12:48 |
fenn | sigh. i'm off to have lunch | 12:48 |
kanzure | anything in particular? | 12:48 |
fenn | freebirds | 12:48 |
kanzure | me me me me | 12:48 |
-!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has joined #hplusroadmap | 12:53 | |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap | 12:55 | |
-!- dira [n=chatzill@86.99.40.183] has quit [Nick collision from services.] | 12:58 | |
-!- dira__ [n=chatzill@86.99.40.183] has joined #hplusroadmap | 12:58 | |
-!- dira__ is now known as dira | 12:58 | |
-!- superkuh_ is now known as superkuh | 13:14 | |
kanzure | hm so sometimes a wire has points, but sometimes it wont and what you really want is an edge | 14:30 |
kanzure | but an edge only sometimes has points | 14:30 |
kanzure | fenn: I'm really really tired of swig telling me that I can't pass something to something else | 15:01 |
kanzure | it breaks dynamic typing | 15:01 |
kanzure | any way around this? | 15:01 |
drazak | kanzure: tito is lulz | 15:09 |
genehacker | ??? | 15:10 |
kanzure | the wangan midnight ost isn't terrible | 15:38 |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 15:40 | |
drazak | fenn: are you ben lipkowitz? | 16:13 |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap | 16:14 | |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Client Quit] | 16:17 | |
kanzure | oo way: 0 points on all wires | 16:19 |
kanzure | non-oo way: 36 points on all wires | 16:19 |
kanzure | however when I let the oo-way consider edges, oo way: 72 points from all of the wires and edges | 16:19 |
kanzure | (and if I let the oo-way to consider only edges and not wires, it's still 72) | 16:20 |
kanzure | which one is the wrong one? | 16:20 |
kanzure | seems to me that all wires are turned into edges in the oop version (even though I'm not doing that) | 16:21 |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Read error: 110 (Connection timed out)] | 16:22 | |
-!- superkuh [n=hukrepus@99.149.170.213] has joined #hplusroadmap | 16:24 | |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Connection timed out] | 16:49 | |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap | 16:49 | |
CIA-32 | skdb: kanzure * r 59f7165 /import_tools/surf.py: committing before some big OO changes | 16:59 |
CIA-32 | skdb: kanzure * r 69bc292 /geom/geom.py: worked on Shape, Face, Wire classes in geom module | 16:59 |
CIA-32 | skdb: kanzure * r 2ed1805 / (4 files in 4 dirs): changed surface approximation code over to oo, plus some unit tests | 16:59 |
-!- dira [n=chatzill@86.99.40.183] has left #hplusroadmap [] | 17:01 | |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has quit [Connection timed out] | 17:11 | |
kanzure | hm | 17:16 |
kanzure | should i continue as if i only had a point cloud? | 17:16 |
kanzure | or take advantage of the faces? | 17:16 |
kanzure | if i assume i only have a point cloud then it will be more generally applicable, although it will likely take longer to figure out | 17:16 |
-!- superkuh [n=hukrepus@unaffiliated/superkuh] has joined #hplusroadmap | 17:17 | |
drazak | 36 kanzure | 17:19 |
kanzure | actually i decided i was ok with 72 and i'll just have to filter out the dupe points | 17:19 |
kanzure | fenn: ok set requires both __eq__ and __hash__ to be defined for its elements | 17:24 |
kanzure | why didn't it throw me an exception? | 17:25 |
drazak | GATA4GCAGCAGCGAGGAGATGCGTGGGGAGAGCTTCAGGGCCGA154NM_002052.3 | 17:25 |
* katsmeow-afk knows only GATTACA | 17:42 | |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap | 17:54 | |
genehacker | wtf | 17:56 |
genehacker | repair person made my laptop worse | 17:57 |
-!- rook [n=rook@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap | 18:02 | |
katsmeow-afk | Gadsden Alabama: man uses hospital equipment to beat on and break out 7th floor window, leaps out, dies. The police say it was an accidental death, determining the man did not intend to hit the ground. | 18:03 |
bkero | what | 18:04 |
katsmeow-afk | huh? | 18:04 |
-!- rook [n=rook@ip68-226-92-62.ri.ri.cox.net] has left #hplusroadmap [] | 18:07 | |
-!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap | 18:08 | |
bkero | I don't expect to hit the ground | 18:10 |
katsmeow-afk | when leaping from a 7th floor window? | 18:11 |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap | 18:19 | |
wrldpc2 | hey rook | 18:20 |
fenn | maybe he thought he could fly. was it a mental hospital? | 18:23 |
fenn | it's surprising how often the answer is obvious | 18:25 |
wrldpc2 | lolwut | 18:25 |
-!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has quit ["Leaving"] | 18:28 | |
-!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has joined #hplusroadmap | 18:29 | |
-!- rook [n=rook4@ip68-226-92-62.ri.ri.cox.net] has quit [Read error: 104 (Connection reset by peer)] | 18:33 | |
-!- wrldpc2_ [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap | 18:36 | |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 104 (Connection reset by peer)] | 18:36 | |
kanzure | is rook some sort of anonymous root? | 18:36 |
-!- wrldpc2_ is now known as wrldpc2 | 18:37 | |
ybit | fenn: you're my hero | 18:38 |
ybit | at least for a second before strange looks start coming my way | 18:39 |
ybit | http://web.mit.edu/2.810/www/lecture/Gutowski - Thermo Analysis.pdf | 18:39 |
ybit | i was thinking about this for the first half of the day today | 18:39 |
wrldpc2 | nah rook is my friend brian, coder from RI | 19:13 |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has quit [Read error: 110 (Connection timed out)] | 19:36 | |
-!- genehacker [i=genehack@wireless-128-62-34-238.public.utexas.edu] has joined #hplusroadmap | 20:12 | |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [Read error: 104 (Connection reset by peer)] | 20:21 | |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has joined #hplusroadmap | 20:22 | |
kanzure | genehacker: paul rothemund is presenting at noon tomorrow | 20:27 |
genehacker | WOAH THANKS | 20:28 |
kanzure | if you want all of his papers, try this: http://heybryan.org/books/papers/rothemund/ | 20:31 |
katsmeow-afk | "As a research fellow at Caltech, Rothemund has developed a technique to manipulate and fold strands of DNA known as DNA Origami." , so if he wanted, he could make a virus to unfold the mad cow prions and fold them back up properly? | 20:36 |
katsmeow-afk | praps he shold run a spell checker before he uploads his creds to wikipedia : "The DNA created would be able to devour certain pollutents in the air" | 20:37 |
kanzure | dont think he put those there | 20:39 |
kanzure | he's kind of popular these days | 20:39 |
katsmeow-afk | ok | 20:39 |
genehacker | and that is why I can't use wikipedia anymore | 20:41 |
katsmeow-afk | i find, if nothing else, it gives me a narrower error window to refute | 20:43 |
ybit | katsmeow-afk: :) | 21:24 |
ybit | anyone used freecad? | 21:24 |
ybit | occ is not gpl compliant iirc, how can you base software (skdb, freecad) on it and make it gpl | 21:24 |
ybit | Archimedes, gcad3d,BRL-CAD, varkon from the open cad group | 21:27 |
ybit | haven't tried 1,2 or 4 | 21:27 |
ybit | http://en.wikipedia.org/wiki/Archimedes_(CAD) | 21:29 |
ybit | http://www.gcad3d.org/ | 21:29 |
ybit | http://varkon.sourceforge.net/ | 21:29 |
ybit | archimedes looks 2d | 21:29 |
ybit | i like how in the vokron's documentation, the 2. Why Varkon? section is completely empty | 21:30 |
ybit | http://gd.tuwien.ac.at/graphics/sced/ Sced is a modelling program that makes use of geometric constraints to edit objects in a virtual world. The scenes created can be exported to a variety of rendering programs, including: | 21:32 |
ybit | * POVray * Radiance * Rayshade * RenderMan(R) compliant programs, such as the Blue Moon Rendering Tools * VRML browsers | 21:32 |
ybit | gcad3d looks the most polished | 21:32 |
ybit | of the unknown cad programs | 21:32 |
ybit | http://www.mindmeister.com/28717702/everything-open-and-free | 21:33 |
ybit | why? please just contribute to skdb already :P | 21:33 |
ybit | so says someone who hasn't | 21:34 |
ybit | I'm afraid some day you're going to start forwarding skdb commit messages | 21:38 |
ybit | directly to the diybio list... | 21:38 |
ybit | :P | 21:38 |
kanzure | is that a suggestion fenn? | 21:43 |
-!- davidnunez__ [n=davidnun@209-6-203-217.c3-0.smr-ubr1.sbo-smr.ma.cable.rcn.com] has quit [] | 21:44 | |
ybit | david nunez is located in austin? | 21:57 |
* ybit is off to bed | 21:58 | |
katsmeow-afk | nite ybit | 21:58 |
ybit | gn katsmeow-afk | 21:59 |
-!- Netsplit orwell.freenode.net <-> irc.freenode.net quits: strages, chizu, fenn_adl, CIA-32, boogles | 22:01 | |
-!- Netsplit over, joins: fenn_adl, strages, CIA-32, boogles, chizu | 22:02 | |
wrldpc2 | name: a good free irc client for linux? | 22:24 |
QuantumG | XChat | 22:25 |
kanzure | irssi, bitchx, thousands of others | 22:25 |
kanzure | emacs? | 22:25 |
genehacker | I here you can't use irssi in public | 22:25 |
QuantumG | XChat is actually usable :) | 22:25 |
genehacker | because people think you're an 3vi1 h4x0r 0h n035!!!!! | 22:26 |
fenn | kanzure: definitely NOT a suggestion | 22:35 |
fenn | hence the "snarkily yours" | 22:36 |
-!- wrldpc2 [n=benny@ool-ad03fe34.dyn.optonline.net] has quit [] | 22:45 | |
genehacker | kanzure have you ever turned in a program as a way to "show work" and did you get away with it? | 23:37 |
genehacker | like for a class assignment | 23:38 |
Generated by irclog2html.py 2.9.2 by Marius Gedminas - find it at mg.pov.lt!