<@kanzure> it's not constantly replicating (is it?) | ||
fenn | hmm | 18:23 |
---|---|---|
fenn | maybe | 18:23 |
fenn | if it has no other leaf nodes, yes | 18:23 |
@kanzure | it has to wait for resource accumulation, you realize | 18:24 |
@kanzure | so it can't constantly be replicating, it will hit run-time errors | 18:24 |
fenn | yes, that's part of replication | 18:24 |
@kanzure | okay | 18:24 |
fenn | it won't assemble the new unit until the parts are built | 18:25 |
@kanzure | so, | 18:25 |
@kanzure | (1) can skdb and autogenix do the package/functionality requirements we need to be able to specify? | 18:26 |
@kanzure | and (2) can we do a small proof of our 'fishing' method for some other design project? | 18:26 |
@kanzure | also, it looks like for each package and functionality we add, we have to include everything that it could possibly be used to do | 18:26 |
@kanzure | and mention its relationships to all existing functionality | 18:26 |
fenn | fishing the ring out of the swamp? | 18:27 |
@kanzure | right | 18:27 |
fenn | there arent any replicators | 18:27 |
fenn | or do you mean just fake it, and prove the algorithm works? | 18:27 |
@kanzure | the algorithm for fishing? | 18:27 |
fenn | s/prove/demonstrate/ | 18:27 |
fenn | yes | 18:27 |
@kanzure | yes, I suppose | 18:27 |
@kanzure | but with packages and functionality in there | 18:28 |
@kanzure | where *we* know a solution | 18:28 |
@kanzure | but we want the computer to find it | 18:28 |
fenn | re:1, skdb/autogenix only exist in our minds right now ;) | 18:28 |
@kanzure | yes, but I mean to say that we get to do functional specs for skdb/autogenix and make sure the file formats could possibly define all of this information that we need | 18:28 |
@kanzure | I guess this is going to be ad-hoc really | 18:29 |
@kanzure | since there's all sorts of variables we will want to include | 18:29 |
fenn | the design can change if it's needed | 18:29 |
@kanzure | perhaps we will make it abstract | 18:29 |
fenn | we can do .agx version 1, version 2, etc | 18:29 |
@kanzure | in the sense that we can "include package-required-for-electricity-variables" | 18:29 |
@kanzure | and then other variables can be further subunits which will each add functionality to the overall project | 18:29 |
epitron | http://kol.coldfront.net/thekolwiki/index.php/Time_sword | 18:30 |
fenn | what variables? diesel for your diesel generator? | 18:31 |
@kanzure | fenn: as well as flow and other information about that fluid | 18:31 |
@kanzure | there's tons of information that CRC keeps on such stuff | 18:31 |
@kanzure | but we can't know all of these variables from first principles | 18:31 |
fenn | true | 18:31 |
@kanzure | so when we want to include a new variable for a new functionality | 18:31 |
@kanzure | we should be able to just add a new 'library' addon thing | 18:31 |
@kanzure | or extension | 18:31 |
@kanzure | which would include subcomponents that would be called upon during simulation | 18:32 |
@kanzure | I think this is the 'virtual function' idea in C/C++ | 18:32 |
@kanzure | or template factory | 18:32 |
@kanzure | not sure. | 18:32 |
fenn | terminology update: streams are run-time capabilities/requirements, packages are build-time, packages can provide streams | 18:32 |
@kanzure | packages still vertices? | 18:33 |
fenn | yes | 18:33 |
@kanzure | packages deliver streams to the new unit? | 18:34 |
fenn | i guess i wasnt specific enough | 18:34 |
@kanzure | no, I think you were | 18:34 |
fenn | streams are things like materials, energy, information | 18:34 |
fenn | i havent figured out if they're vertices or edges yet | 18:34 |
fenn | there's going to be a lot of streams that have no package providing them, like sunlight, air | 18:35 |
fenn | the aluminum smelter relies at run-time on the clay processor to provide bauxite | 18:36 |
fenn | smelter, processor = packages | 18:36 |
fenn | clay, bauxite = streams | 18:36 |
@kanzure | streams sound kind of like vectors | 18:37 |
fenn | then you can have a factory object that makes packages | 18:37 |
fenn | a package that makes packages | 18:37 |
@kanzure | including itself? | 18:38 |
fenn | let's not go there :) | 18:38 |
@kanzure | isn't that what we wanted in the first place? | 18:38 |
fenn | yes of course | 18:38 |
fenn | but there are lots of intermediate packages that make other packages (i guess) | 18:39 |
fenn | maybe that's just poor refactoring on society's part | 18:39 |
@kanzure | that was my 'criss-crossing' example: where package X requires stream Y during build-time to reproduce package X in the new unit, but in normal operations, package Y would require stream X, or something | 18:39 |
@kanzure | erm | 18:40 |
@kanzure | criss-crossing: | 18:40 |
@kanzure | Note that the "sand-processing subsystem" need not be made out of sand. The "sand-processing subsystem" needs to be made out of X mineral where there exists in the design "X-processing subsystem" which, again, is not necessarily made out of X, but it has to be made out of something like "X" that eventually makes it full circle back to sand. | 18:40 |
fenn | ah a sub-loop | 18:40 |
@kanzure | so, package X (which processes Y) needs to be made out of stream L where stream L is | 18:40 |
@kanzure | I am having trouble variabilizing it, because it's a hard statement to make | 18:40 |
fenn | the loop is in stream-space, whereas the package tree is very linear and loop-free | 18:41 |
fenn | maybe draw a diagram | 18:41 |
epitron | TIME SWORD! | 18:41 |
@kanzure | the dependency loops are important, of course | 18:41 |
@kanzure | let's see | 18:41 |
fenn | the subtle knife | 18:42 |
@kanzure | (($mineralX)-processing-subsystem) can be made out of $mineralY, where there exists in the overall design a (($mineralY)-processing-subsystem), which either must immediately be made out of ($mineralX) or some (($mineralI-don't-care)-processing-subsystem) which eventually is made out of ($mineralX) | 18:43 |
@kanzure | where: | 18:43 |
@kanzure | you would probably say the mineralX-processing-subsystem is a package, yes? | 18:43 |
@kanzure | and then streams would be tapped during build-time by a certain package to manufacture a new package, for the replicated entity to have. | 18:44 |
fenn | i'm not convinced this is a problem we have to worry about | 18:46 |
@kanzure | how so? | 18:47 |
fenn | do you think a loop will kill the dependency resolution code? | 18:47 |
@kanzure | no? | 18:47 |
@kanzure | it's not a problem | 18:48 |
@kanzure | we're just formalizing what we need | 18:48 |
@kanzure | right? | 18:50 |
fenn | yah | 18:54 |
fenn | its funny, usually i'm trying to cut apart dependency loops, but for self-replication they're quite useful | 18:58 |
@kanzure | the more the better (in terms of design) | 18:59 |
@kanzure | but the more the worse, in terms of implementation | 18:59 |
fenn | grr do they really expect me to pay money for nasa publications? | 19:09 |
@kanzure | here's my attempt at defining a package: | 19:11 |
@kanzure | a package must (1) be made of a certain material, (2) has an input stream that gives it a material to make, (3) this input material is different than the material in #1, and (4) a package must make *some other package* with the input stream material. | 19:11 |
fenn | package must make a package? | 19:12 |
@kanzure | yep | 19:12 |
@kanzure | must make *another* package | 19:13 |
fenn | what about instruments | 19:13 |
@kanzure | and that other package might end up making the original package | 19:13 |
@kanzure | a package might be a fabricator, and that fabricator, by coincidence, can make extra stuff | 19:13 |
@kanzure | like an instrument | 19:13 |
fenn | i mean sensors, like an oscilloscope or something | 19:13 |
fenn | a spectrometer | 19:13 |
fenn | what does the spectrometer make? | 19:14 |
@kanzure | right, it makes nothing | 19:14 |
@kanzure | so these are your leaves | 19:14 |
@kanzure | leafs | 19:14 |
fenn | it makes information, which is necessary for replication | 19:14 |
@kanzure | interesting | 19:14 |
fenn | i feel funny calling data a package | 19:14 |
@kanzure | instrument == package? | 19:15 |
fenn | well sure, it's a collection of components that performs a function | 19:15 |
fenn | and there are control instruments that dont produce 'information' exactly | 19:16 |
fenn | the computer that's directing operations | 19:16 |
@kanzure | arrgh | 19:17 |
@kanzure | I just wrote down "Reverse Method of Making a Fabricator" | 19:17 |
@kanzure | (1) start with a fabricator | 19:17 |
@kanzure | 'erm, replicator | 19:17 |
@kanzure | (2) Break it down into its components. | 19:17 |
fenn | well gee with #1 we're already done :) | 19:17 |
@kanzure | (3) Make a machine to do the reverse. Done. | 19:17 |
@kanzure | heh' | 19:17 |
@kanzure | yeah :( | 19:17 |
@kanzure | man, relying on biology really helps though | 19:17 |
@kanzure | it gives you something to start with | 19:18 |
@kanzure | because if you want to be able to create enough for a human to live and grow | 19:18 |
@kanzure | then you can just require your materials for self-replication rely on that same stuff | 19:18 |
fenn | human is too complex, start with a minimal bacterial cell | 19:18 |
@kanzure | okay, what's agar made out of? | 19:18 |
@kanzure | unbranched polysaccharide? | 19:18 |
fenn | input streams: amino acids, sugar, nucleic acids, lipids, salts | 19:18 |
@kanzure | `Agar is a heterogeneous mixture of two classes of polysaccharide: agaropectin and agarose` | 19:19 |
fenn | now we need proteins to import each of those streams into the cell | 19:19 |
fenn | then there are assemblies of proteins that turn those streams into higher order molecules, like proteins and nucleic acids | 19:19 |
@kanzure | huh? | 19:20 |
fenn | nucleic acid polymers :) | 19:20 |
@kanzure | we don't need those proteins, do we? | 19:20 |
@kanzure | just make agar for the bacteria and that's it | 19:20 |
fenn | i'm talking about how the bacterium works | 19:20 |
@kanzure | hell, I am sure we can make bacteria that can eat moon rock | 19:20 |
@kanzure | that's hacking the bacterium | 19:20 |
@kanzure | not really necessary IMO | 19:20 |
fenn | no, as a model for how replicators work in general | 19:20 |
@kanzure | ah | 19:20 |
@kanzure | okay, so then the packages that we would define | 19:21 |
@kanzure | would they be genes and protein expressions ? | 19:21 |
fenn | take te bacteria apart, abstract and generalize the functions and structure, put it back together using other technologies | 19:21 |
@kanzure | remember the Minimal Cell Project? | 19:21 |
fenn | i've heard of it, not read much though | 19:21 |
@kanzure | http://heybryan.org/mediawiki/index.php/Minimal_cell_project | 19:21 |
@kanzure | lucky for you, I have a page | 19:22 |
@kanzure | we could try to model the whole damn cell, I guess | 19:22 |
@kanzure | and then figure out how to apply our terminology to it | 19:22 |
fenn | yeah | 19:22 |
@kanzure | isn't that kind of cheating, shouldn't we be able to come up with the model ourselves? | 19:25 |
@kanzure | and why can't we use von Neumann's work on theoretical self-replicators? | 19:25 |
@kanzure | surely there must be somebody who has been exploring the mathematics of this topic | 19:25 |
fenn | i was just trying to make sense of your 'reverse method' | 19:25 |
@kanzure | we're operating on many different levels here | 19:26 |
@kanzure | ah | 19:26 |
@kanzure | well, I see what you mean in that case | 19:26 |
@kanzure | the other reverse methods that I have been proposing are different of course | 19:26 |
@kanzure | such as starting with a fabricator arm that can move "completed components" to assemble the fabricator arm itself | 19:26 |
@kanzure | and then adding in the closed-form dependency loops to make all of the components on the shelf | 19:27 |
@kanzure | which is a reverse recursive definition method, but not quite the same thing as starting with a cell instead | 19:27 |
fenn | that's the reprap way, but unfortunately plastic goo isnt good for shit | 19:27 |
fenn | so you have to start with something that has potential | 19:27 |
fenn | and legos, have you ever tried to manufacture something using only legos? | 19:28 |
@kanzure | nope | 19:28 |
@kanzure | but | 19:28 |
@kanzure | I wonder if it would be possible to make a lego factory out of legos | 19:28 |
fenn | i saw a youtube where a 'factory' was assembling legos.. looked godawful inefficient | 19:28 |
fenn | the factory was made of legos too | 19:29 |
@kanzure | it surely had some electronics or someting | 19:29 |
@kanzure | *something | 19:29 |
fenn | yes there's an electronics brick | 19:29 |
fenn | i guess you could use control cams like in a screw machine (not that legos lend themselves to that method) | 19:29 |
@kanzure | Google isn't being kind to me - not much info on synthesis of agar | 19:30 |
@kanzure | or agarose for that matter | 19:30 |
fenn | agar is made of agarose :) | 19:30 |
@kanzure | but it occurs to me that there does exist such things as aerobic bacteria | 19:30 |
fenn | its refined from seaweed, fuchus i think | 19:30 |
@kanzure | hrm | 19:30 |
@kanzure | that's not good | 19:30 |
fenn | agarose is not a nutrient | 19:30 |
@kanzure | how does fuchus make it? | 19:30 |
@kanzure | ooh | 19:30 |
fenn | it's used for bacteria because they can't digest it | 19:30 |
@kanzure | well, we can just have giant water tanks pointed at the sun | 19:30 |
@kanzure | oh? | 19:30 |
fenn | so you get a nice smooth plate with bumps sitting on top | 19:31 |
fenn | instead of having the bacteria forming branching colonies inside the agar | 19:31 |
fenn | well, they do that too, but it doesnt break down at least | 19:31 |
fenn | if the agar broke down it would turn into a pool of slime | 19:31 |
fenn | lego factory: http://www.youtube.com/watch?v=GQ3AcPEPbH0 | 19:33 |
fenn | with some odometry that whole thing could be replaced by a car with a gripper | 19:37 |
fenn | the minimal cell project has too much information processing in the form of molecules, it's like a factory made of cams and levers | 19:40 |
fenn | so it's a bad model to follow for macro-scale replicators | 19:41 |
@kanzure | take a look at this | 19:41 |
@kanzure | http://heybryan.org/mediawiki/index.php/Self-replication#Sipper_excerpt | 19:41 |
@kanzure | http://en.wikipedia.org/wiki/Langton's_loops | 19:42 |
fenn | sure but it relies on the cellular grid being just right | 19:42 |
fenn | the rules of the universe, if you will | 19:42 |
fenn | von neumann's design separates structure from information, which is desirable when dealing with a fuzzy non-digital universe | 19:45 |
@kanzure | http://ti.arc.nasa.gov/people/jlohn/bio.html <-- good guy to know | 19:46 |
fenn | so now we have DNA and proteins, instead of an RNA-based ribozyme mishmash | 19:46 |
@kanzure | "the rules of the universe, being just right" --> With any sufficient preparation ... | 19:46 |
fenn | neat stuff | 19:47 |
@kanzure | http://lslwww.epfl.ch/pages/embryonics/ interesting | 19:48 |
fenn | evolution is good at circuit-hiding :\ | 19:50 |
@kanzure | it doesn't look like anybody has actually focused on the mathematics of self-replication, away from cellular automata | 19:51 |
@kanzure | in fact, why the hell has cellular-automata been used in the first place | 19:51 |
@kanzure | this should have been graph based since the beginning | 19:51 |
fenn | because cellular automata is a math-based representation of 'the real world' | 19:51 |
@kanzure | so if we had a cellular automata configuration file that was a self-replicator | 19:52 |
fenn | also because, in math you can just say 'a = b' and you're done | 19:52 |
@kanzure | how would we use that to help us find a material implementation | 19:52 |
fenn | well, remember they came up with the information tape before DNA was discovered | 19:52 |
@kanzure | so? | 19:53 |
fenn | what if we hadn't discovered DNA? | 19:53 |
@kanzure | heh, we'd still be stuck on CAs. | 19:53 |
fenn | i guess they had paper tape already | 19:54 |
fenn | anyway, i dont know what the CA simulation is good for | 19:54 |
@kanzure | nothing as far as I can tell | 19:54 |
@kanzure | looks like we were going in the right direction with our definitions/graph-theory approach | 19:54 |
@kanzure | with the extendible simulator to generate posisble reactions and interactions between streams so that we can figure out if we have missed any optimizations | 19:55 |
fenn | btw have you ever seen animations of the vonneumann replicator? it's really cool to watch | 19:56 |
@kanzure | nope | 20:01 |
fenn | well too bad, you probably never will :P | 20:01 |
@kanzure | hm, this is interesting - 1. W.M.Stevens "NODES: An Environment for Simulating Kinematic Self-Replicating Machines" Proc. of the Ninth International Conference on the Simulation and Synthesis of Living Systems (ALIFE9) 39-44, 2004. | 20:03 |
@kanzure | the guy's web site - http://www.srm.org.uk/home.html | 20:03 |
fenn | yep found it | 20:04 |
fenn | looks quite biological | 20:07 |
fenn | havent any of these guys heard of a tape reel? :) | 20:08 |
@kanzure | http://www.landesbioscience.com/books/special/id/912 | 20:10 |
@kanzure | $150. I may just have to go beg Freitas. | 20:10 |
@kanzure | Or maybe Max can lend me his copy, if he has it. | 20:10 |
fenn | it's on his website | 20:12 |
fenn | http://www.molecularassembler.com/KSRM.htm | 20:13 |
fenn | i need to read that too | 20:13 |
@kanzure | let's wiki it | 20:13 |
fenn | wiki what? the whole thing? :) | 20:14 |
fenn | gosh there are a lot of citations | 20:15 |
@kanzure | yep | 20:16 |
@kanzure | http://heybryan.org/mediawiki/index.php/KSRM | 20:26 |
@kanzure | my start to it | 20:26 |
fenn | this book must be rather heavy | 20:26 |
@kanzure | Freitas is a peculiar fellow. I saw him on video once, he had no clue as to how to run a presentation. He was reading straight from a transcript, looking down, was not energetic, very monotonous tone. But if he's really all that he's cracked up to be ... | 20:27 |
@kanzure | fenn: http://heybryan.org/mediawiki/index.php/KSRM/3 | 21:18 |
@kanzure | it's getting all messed up | 21:18 |
@kanzure | http://heybryan.org/projects/ksrm/output.txt has the entire wiki code for the book, sort of | 21:19 |
@kanzure | but it's all out of order I think | 21:19 |
@kanzure | oh wait, nevermind | 21:19 |
@kanzure | hm, | 21:37 |
@kanzure | Freitas cites Winfree. | 21:37 |
@kanzure | 1175. Brent A. Ridley, B. Nivi, Joseph M. Jacobson, “All-inorganic field effect transistors fabricated by printing,” Science 286(22 October 1999):746-749; http://www.media.mit.edu/molecular/Science10-99.pdf | 21:38 |
@kanzure | 1987. Kinneret Keren, Rotem S. Berman, Evgeny Buchstab, Uri Sivan, Erez Braun, “DNA-templated carbon nanotube field-effect transistor,” Science 302(21 November 2003):1380-1382, 1310 (comment). See also: “DNA used to create self-assembling nano transistor,” ISRAEL21c, 23 November 2003; http://www.israel21c.org/bin/en.jsp?enPage=BlankPage&enDisplay=view&enDispWhat=object&enDispWho=Articles%5el557&enZone=Technology&enVersion= | 21:39 |
@kanzure | fenn: it occurs to me that we can use humans as the 'black box' for as long as we want for self-replication, slowly porting over certain functions to the actual hardware, until eventually the machine replicates on its own | 22:03 |
fenn | reading the printed FET paper.. i wonder if the nanocrystals could be aligned by an externally applied electric field | 22:05 |
fenn | kanzure: it's more than just 'humans' it's industrial civilization | 22:06 |
@kanzure | as long as we can move all of the functionality over to the human, we're good | 22:06 |
fenn | i dont know how to make aluminum from scratch :P | 22:06 |
@kanzure | what printed FET paper? | 22:06 |
@kanzure | are you reading my nanocrystals page? | 22:06 |
fenn | all inorganic field effect transistors fabricated by printing | 22:07 |
fenn | you just linked to it | 22:07 |
@kanzure | oh | 22:09 |
@kanzure | well | 22:09 |
@kanzure | more on semiconductor nanocrystals - http://heybryan.org/alternate_transistors.html | 22:09 |
@kanzure | i.e., printed FETs. | 22:09 |
@kanzure | but this isn't the DNA-based FETs. | 22:09 |
fenn | i cant load the israel21c.org url | 22:10 |
@kanzure | http://web.archive.org/web/*/http://www.israel21c.org/bin/en.jsp?enPage=BlankPage&enDisplay=view&enDispWhat=object&enDispWho=Articles%5el557&enZone=Technology&enVersion=0& | 22:11 |
fenn | did you ever read about qtc pills? | 22:11 |
@kanzure | "The DNA serves as a scaffold, a template that will determine where the carbon nanotubes will sit," Braun said. | 22:14 |
@kanzure | hmm | 22:14 |
@kanzure | nope | 22:14 |
@kanzure | looks like pressure-based switches? | 22:15 |
fenn | yes | 22:15 |
fenn | they're rubber-state switches | 22:15 |
fenn | well, variable resistors | 22:16 |
fenn | the fabrication sounds really low tech | 22:17 |
fenn | mix nickel powder and adhesive | 22:17 |
@kanzure | woah | 22:18 |
@kanzure | that's definitely worth it | 22:18 |
@kanzure | why haven't I seen more of this | 22:18 |
@kanzure | searching for 'qtc pills' doesn't show up much but a single company's website | 22:18 |
@kanzure | can you get me some other links or something ? | 22:18 |
fenn | it's fairly new, and there's only one company developing it (the inventor) | 22:18 |
fenn | hell if i know why it isnt more widespread | 22:19 |
fenn | popular article on the history of qtc http://www.sep.org.uk/catalyst/articles/catalyst_18_1_333.pdf | 22:34 |
@kanzure | hm | 22:40 |
fenn | i wonder if you could make a composite material that was both a qtc-resistor and a piezo actuator | 22:42 |
fenn | so a small electric field would change the conductivity | 22:42 |
fenn | it would probably have to be anisotropic, like a fiber embedded in silicone rubber | 22:42 |
@kanzure | how does a piezo actuator work? | 22:42 |
fenn | good question | 22:43 |
@kanzure | is it just a simple case of applying a current and making it move? | 22:43 |
@kanzure | I am pretty sure piezo actuator == piezo buzzer | 22:44 |
@kanzure | `http://www.sep.org.uk/catalyst/articles/catalyst_18_1_333.pdf` | 22:44 |
@kanzure | oops | 22:44 |
@kanzure | Inkjet printers: On some inkjet printers, particularly those made by Epson, piezoelectric crystals are used to control the flow of ink from the inkjet head to the paper. | 22:44 |
fenn | i think piezoelectric materials deform due to voltage, but there is a certain amount of charge that must be transfered (as if it were a capacitor) | 22:44 |
@kanzure | Piezoelectric motors: piezoelectric elements apply a directional force to an axle, causing it to rotate. Due to the extremely small distances involved, the piezo motor is viewed as a high-precision replacement for the stepper motor. | 22:45 |
fenn | yeah the piezo inkjets physically squirt the ink onto the page | 22:45 |
@kanzure | yes, piezoelectrics work just like that | 22:45 |
fenn | ugh, no, ignore the piezoelectric motor snippet | 22:45 |
@kanzure | but I have not figured out how that applies to piezo steppers / actuators | 22:45 |
@kanzure | oh? | 22:45 |
@kanzure | because that doesn't make sense | 22:45 |
@kanzure | if you apply a voltage | 22:45 |
@kanzure | it will deform and push the axil | 22:45 |
@kanzure | but then when you stop the voltage | 22:45 |
@kanzure | it should just move back to where it started | 22:45 |
@kanzure | which makes no sense :) | 22:46 |
fenn | you can cause rotational motion, but not _continuous_ rotation | 22:46 |
fenn | unless you have some ratchet mechanism or something | 22:46 |
@kanzure | I doubt they are using ratchets | 22:46 |
@kanzure | because you're using twice the energy | 22:46 |
@kanzure | that you need. | 22:46 |
@kanzure | where's Superkuh when you need him? heh' | 22:47 |
@kanzure | he's a self-made expert in piezos last time I checked | 22:47 |
@kanzure | was designing a piezo-based particle accelerator | 22:47 |
fenn | you could use a piezo actuator as the replacement for a piston in an engine (sorta) | 22:47 |
fenn | ah i bet he was doing something with fusion | 22:47 |
fenn | lithium deuteride crystals yes? | 22:48 |
@kanzure | so how would you cause rotational motion with piezos? | 22:48 |
@kanzure | let me chekc | 22:48 |
@kanzure | Ferroelectric/pyroelectric particle accelerators and research with homebrew methods. | 22:48 |
@kanzure | [context pressure ~=10^-3 Pa] Has anyone considered using pyroelectric crystal mediated acceleration of charged particles (spontaneous polarization of voltage oriented through the c-axis crystal faces (when heating the , +z surface has a negative potential and the -z surface has a positive potential, reverse for cooling) as the result of shifting ions in the crystal shape/lattice combined with funky dilute gas charge masking behav | 22:48 |
@kanzure | Particle (electrons or ions depending on the crystal face and heat/cool cycle) energies up in the 150keV+ range are very doable (or 200kev+ with dilute light gases and a bipolar setup). Plus with cylindrical crystals the beams are self focusing. A common choice for this is Lithium Tantalate, and making thin films and stacking this material is possible, but there are lots of tricks involved (and making crystal boules is a magnitud | 22:48 |
fenn | that's pyroelectric, not piezoelectric | 22:49 |
@kanzure | yeah .... oops. | 22:49 |
@kanzure | but | 22:49 |
@kanzure | he's the guy that introduced me to piezoelectricity | 22:49 |
fenn | i see | 22:49 |
fenn | well, anyway, there are piezoelectric polymers (kynar/polyvinylidene) | 22:50 |
@kanzure | hm, that's convenient | 22:51 |
fenn | but the most promising are ceramic | 22:51 |
@kanzure | but how does the rotational motion work that you were mentioning? | 22:51 |
fenn | a piston in a car engine goes up and down, so replace the piston with a piezo actuator | 22:51 |
fenn | the crank turns reciprocating motion to rotation | 22:51 |
fenn | there's more ways to do it | 22:52 |
@kanzure | huh | 22:52 |
fenn | like a clock wheel, hit each tooth with a hammer as it goes by | 22:52 |
@kanzure | so if you just do rapid voltage pulses | 22:52 |
@kanzure | you'd convert this into rotational motion with a crank | 22:52 |
fenn | i saw a 'wiggle motor' somewhere | 22:52 |
fenn | it's a piezo rod that wiggles its way around, using a gearing principle similar to harmonic drives to provide a decent output torque | 22:53 |
fenn | it was about 5mm wide 20mm long | 22:56 |
fenn | cylinder | 22:56 |
@kanzure | not much turning up on Google. | 22:56 |
fenn | http://www.newscaletech.com/squiggle_overview.html | 22:58 |
@kanzure | that's really convenient | 23:01 |
@kanzure | I wonder how we could make it. | 23:02 |
@kanzure | It looks like just a piezo + voltage + ... I don't know what. | 23:02 |
@kanzure | either a rachet or a crank | 23:02 |
@kanzure | from Superkuh's bookmarks - http://www.pollin.de/shop/shop.php?cf=detail.php&pg=NQ==&a=MDA5OTQ3OTk= giant piezo crystals | 23:03 |
@kanzure | http://www.chem.pacificu.edu/Johnson/JohnsonResearch/STM/PIEZO.HTM piezo tube | 23:04 |
@kanzure | http://www.colomar.com/Shavano/mini_piezo_tweeter.html DIY mini piezo tweeter | 23:04 |
@kanzure | Hm, in my trash I apparently have a Google search for pyroelectrical transistors - | 23:04 |
http://www.google.com/search?client=opera&rls=en&q=pyroelectric+transistor&sourceid=opera&ie=utf-8&oe=utf-8 | ||
fenn | wow that's cheap (pollin.de) | 23:05 |
@kanzure | maybe we should stock up ;) | 23:07 |
fenn | the piezo tube looks like what the squiggle motor uses | 23:09 |
fenn | heh, go back on that page it says 'inchworm motor housing' for STM | 23:10 |
@kanzure | the piezo tube is for motion in x/y/z directions, not up/down, although ... if we could find a piezo that could change shape by say, 5 mm or something, that would be great | 23:11 |
@kanzure | or I guess it doesn't have to be too much | 23:11 |
@kanzure | it could just be a rubber band stretching system | 23:11 |
fenn | oh i guess 'inchworm motor' is the stick-slip thing i keep reading about | 23:11 |
@kanzure | http://en.wikipedia.org/wiki/Inchworm_motor | 23:12 |
fenn | why 5mm? what do you plan to do with it? | 23:12 |
@kanzure | well | 23:12 |
@kanzure | a 1 m piezo would be great | 23:12 |
@kanzure | as a piston or something :) | 23:12 |
@kanzure | http://www.physikinstrumente.com/en/news/fullnews.php?newsid=123&Wiki_iw I hate this website, but it's about the principles of the inchworm motor | 23:13 |
@kanzure | physikinstrumente spams all over the place | 23:13 |
@kanzure | tons of domain squatting | 23:13 |
@kanzure | if this piezo motor can scale from 1 Newton to up to thousands of Newtons that'd be great | 23:14 |
fenn | a motor might have force and speed but not at the same time | 23:15 |
fenn | but why does it matter? what are you going to use it for? | 23:15 |
@kanzure | huh? | 23:16 |
@kanzure | I was assuming you had a few ideas | 23:16 |
@kanzure | for using it in a replicator | 23:16 |
fenn | well, i never considered piezo's to be useful for producing mechanical power | 23:16 |
fenn | that might be a mistake on my part | 23:16 |
@kanzure | it looks fairly convenient | 23:17 |
fenn | did you notice the efficiency chart? looks like they are much less efficient when size goes up | 23:17 |
@kanzure | hrm | 23:18 |
@kanzure | qtc-resistor + piezo would be really useful though | 23:18 |
fenn | on the right side of here http://www.newscaletech.com/doc_downloads/SQUIGGLE_Overview_2-18-08.pdf | 23:18 |
@kanzure | combines a lot of parts | 23:18 |
fenn | yes, i was thinking mainly piezos for squeezing qtc's to control a more conventional motor | 23:19 |
fenn | like, a pancake motor or switched reluctance | 23:19 |
fenn | voltage is easy to get from a tiny computer chip | 23:20 |
fenn | anyway this all needs some empirical data | 23:20 |
fenn | i've never used either qtc's or piezo's | 23:21 |
@kanzure | the qtc research group should be responsive | 23:24 |
@kanzure | http://www.dur.ac.uk/psm.group/qtc.html | 23:24 |
fenn | i'd like to know if there are other metals besides nickel that form nano-spikes | 23:26 |
@kanzure | I need to take a break from this stuff and go figure out a circuit for Andy ... he wants me to come up with something that has an emergent property | 23:27 |
@kanzure | but this is pretty hard | 23:27 |
@kanzure | I am thinking about telling him about my 'evolvable DNA logic circuits' idea, but I think that's sidestepping his request | 23:27 |
fenn | something with an emergent property eh | 23:28 |
@kanzure | heh' | 23:28 |
fenn | cats and dogs and buttered toast! | 23:28 |
@kanzure | he cited the ring oscillator as the "classic example" | 23:28 |
@kanzure | indeed | 23:28 |
@kanzure | the oscillator example is really simple and takes up a huge class of possibilities | 23:29 |
@kanzure | so I can't do anything that oscillates | 23:29 |
@kanzure | I was thinking about trying to implement sine | 23:30 |
@kanzure | but that's analog, whereas this is discrete-state | 23:30 |
fenn | forget about emergence, come up with something that has 'a spiritual property' | 23:30 |
fenn | they're both meaningless words | 23:31 |
@kanzure | then what should I implement | 23:32 |
@kanzure | calculations are mostly meaningless in this context | 23:32 |
@kanzure | although the prospects are interesting for large-scale computing really | 23:32 |
@kanzure | because if you have a few million gates for a single circuit | 23:33 |
@kanzure | and want to do simultaneous computation all at once | 23:33 |
@kanzure | then you have them all extremely localized | 23:33 |
@kanzure | if you have it acting in a centrifuge then it would be interesting to store the result of the computation eventually, but I don't see how | 23:33 |
@kanzure | maybe a flip flop system | 23:33 |
@kanzure | but there's no guarantee of saturation or propagation of all of the same states to all of the flip flops | 23:34 |
@kanzure | hrm | 23:34 |
@kanzure | maybe a massive cellular automata implementation | 23:35 |
@kanzure | where the logic gates are the cells | 23:35 |
@kanzure | each logic gate has four neighbors, and they are all executed in parallel, so what would happen? | 23:36 |
fenn | *drool* http://sourceforge.net/projects/xandra | 23:36 |
@kanzure | awesome | 23:36 |
fenn | how do you connect the neighbors? through winfree's toehold addressing mechanism? | 23:38 |
@kanzure | yes | 23:44 |
@kanzure | and in this scenario, | 23:44 |
@kanzure | you don't have to be too specific either | 23:44 |
@kanzure | since you can have four neighbors for each 'cell' | 23:45 |
@kanzure | heh | 23:45 |
@kanzure | so that means I don't have to be as strict when selecting the toeholds and the recognition sequences | 23:45 |
@kanzure | sneaky, isn't it? | 23:45 |
fenn | screenshot from xandra showing a hexaglide actuator: http://imagebin.org/15164 | 23:46 |
fenn | i dont get it. the reason you have to be strict when selecting toehold sequences is to reduce crosstalk | 23:48 |
@kanzure | yes | 23:48 |
@kanzure | well | 23:48 |
@kanzure | not only that | 23:48 |
fenn | crosstalk will bunch up your fabric | 23:48 |
@kanzure | but you also don't want one toe-hold to match for the wrong logic gate | 23:48 |
@kanzure | it's kind of like a lock-and-key method | 23:48 |
@kanzure | where the logic gate output is a key to the next one in the pathway | 23:48 |
@kanzure | so if your key unlocks the 4 neighboring cells .. | 23:48 |
@kanzure | where 'cells' are really just gates | 23:48 |
fenn | 'cell' as in cellular automata right? not bacterial cell | 23:50 |
fenn | blah my brain is hurting | 23:51 |
@kanzure | right | 23:52 |
fenn | another xandra screenshot http://imagebin.org/15165 | 23:52 |
@kanzure | heh | 23:52 |
@kanzure | so what does it simulate | 23:53 |
@kanzure | just a 3D visualization? | 23:53 |
fenn | machine tool kinematics | 23:53 |
@kanzure | ooh | 23:53 |
fenn | windows only right now or i'd be playing with it | 23:54 |
@kanzure | wine? | 23:54 |
Day changed to 23 Mar 2008 | ||
@kanzure | fenn: you wouldn't happen to remember how to use the X11 screenshot feature to take a snapshot of a particular program? | 00:04 |
fenn | i use ksnapshot | 00:05 |
@kanzure | I need to automate it. I think there was a program named xsd or something. | 00:05 |
fenn | try `man import` | 00:05 |
@kanzure | okay | 00:06 |
fenn | with import you have to click on the window.. | 00:06 |
fenn | xwd is what you're remembering | 00:09 |
@kanzure | yes | 00:12 |
@kanzure | thank you | 00:12 |
@kanzure | turns out xplanet ( http://xplanet.sf.net/ ) does image output itself | 00:12 |
@kanzure | so all is good | 00:12 |
@kanzure | a guy from the Moon Society wants me to write a quick script to show the earth from the moon at the given moment | 00:13 |
@kanzure | he said his web dev team has been at it for two years | 00:13 |
@kanzure | I laughed and set it up in 2 minutes :( | 00:13 |
fenn | two years! | 00:13 |
@kanzure | script kiddies do better than two years ... | 00:14 |
fenn | i feel like i've been doing JITT (just in time training) for a few years now | 00:18 |
fenn | exhibiting symptoms of 'jitt-stick' | 00:19 |
fenn | wikipedia overdose | 00:19 |
@kanzure | JITT indeed | 00:24 |
@kanzure | but what can be done about that | 00:24 |
fenn | mobile computing for exercise (faster removal of brain waste products, increased oxygen) | 00:27 |
fenn | might cause more harm than good though, you could walk into the street or something | 00:27 |
-!- kanzure [n=bryan@cpe-70-113-54-112.austin.res.rr.com] has quit ["Leaving."] | 02:16 | |
[Users #hplusroadmap] | 05:06 | |
[ Enki-2] [ epitron] [ fenn] | 05:06 | |
-!- Irssi: #hplusroadmap: Total of 3 nicks [0 ops, 0 halfops, 0 voices, 3 normal] | 05:06 | |
fenn | Light from the sun hitting lunar dust causes it to become charged through the photoelectric effect. The charged dust then repels itself and lifts off the surface of the Moon by | 05:07 |
electrostatic levitation. | ||
fenn | It is thought that the smallest particles are repelled up to kilometers high, and that the particles move in "fountains" as they charge and discharge. | 05:07 |
-!- fenn_ [n=pz@adsl-76-251-81-249.dsl.bltnin.sbcglobal.net] has joined #hplusroadmap | 05:23 | |
[Users #hplusroadmap] | 05:23 | |
[ Enki-2] [ epitron] [ fenn] [ fenn_] | 05:23 | |
-!- Irssi: #hplusroadmap: Total of 4 nicks [0 ops, 0 halfops, 0 voices, 4 normal] | 05:23 | |
-!- [freenode-info] if you're at a conference and other people are having trouble connecting, please mention it to staff: http://freenode.net/faq.shtml#gettinghelp | 05:23 | |
-!- Channel #hplusroadmap created Sat Mar 22 15:44:12 2008 | 05:23 | |
kanzure | http://archives.seul.org/geda/dev/Nov-1999/msg00120.html | 13:26 |
kanzure | EDIF 2 format | 13:26 |
kanzure | oh | 13:26 |
kanzure | heh | 13:26 |
kanzure | good old ~rcary | 13:26 |
kanzure | http://www.rdrop.com/~cary/mirror/tools_htmlized.html | 13:26 |
kanzure | This guy is a god. | 13:27 |
kanzure | David Cary. | 13:27 |
kanzure | http://www.rdrop.com/~cary/html/idea_space.html <-- read this like a bible | 13:27 |
kanzure | http://www.geda.seul.org/wiki/geda:icarus_xnf | 13:31 |
kanzure | gEDA can do XNF. | 13:31 |
fenn | heh i'm reading ~cary and he's slipping into orion's arm lingo | 13:32 |
kanzure | yes | 13:32 |
kanzure | I've emailed him over the years. He doesn't seem to exist any more. | 13:33 |
fenn | reduced information diet | 13:35 |
kanzure | From #electronics | 13:38 |
kanzure | (2008-03-16 12:39:35) gordboy: i'd like to see store "disloyalty" cards. you pop in your card and it injects a virus into the system and causes all the wheels and dials to spin | 13:38 |
hopelessly out of control, while technicians with suspiciously german-sounding accents rush around shouting "gott und himmel. donner und blitzen" | ||
kanzure | screw it, I could have been done by now with a 'logic' grammar | 13:39 |
kanzure | just need something that can do "output1 = input1 xor input2 xor input3" | 13:39 |
fenn | um, how bout C? | 13:39 |
kanzure | but it compiles into bytecode | 13:39 |
fenn | what kind of bytecode? | 13:39 |
kanzure | I mean, the machine code for the specified architecture | 13:40 |
kanzure | oh | 13:40 |
kanzure | I wonder how to specify the architecture | 13:40 |
kanzure | and the specified architecture would thus be DNA | 13:40 |
fenn | i think that's the hard part | 13:40 |
kanzure | Quick! to #gcc ! | 13:41 |
kanzure | maybe it would be technically smarter to | 13:43 |
kanzure | make an assembler | 13:43 |
fenn | assembler assumes a linear sequence, whereas what you are building is inherently parallel execution | 13:44 |
kanzure | nopre | 13:44 |
kanzure | *nope | 13:44 |
kanzure | surprisingly not | 13:44 |
kanzure | assume one DNA molecule per cell | 13:44 |
kanzure | and the gene, the nucleotides on the molecule, *that's* the gate | 13:44 |
fenn | :3 | 13:44 |
kanzure | bwahah | 13:45 |
kanzure | so now I just need to look for a simple assembly language | 13:45 |
kanzure | I will _not_ implement x86 or MIPS. Screw that. | 13:45 |
fenn | something's walking down the molecule though, recombining at various places | 13:45 |
kanzure | so? | 13:45 |
fenn | you can have more than one of those | 13:46 |
kanzure | yeah, but there's only one gate | 13:46 |
kanzure | it's just asynchronous logic | 13:46 |
kanzure | it's a bottleneck | 13:46 |
fenn | what is the 'something'? | 13:46 |
kanzure | your 'something'? | 13:46 |
kanzure | I thought it was RNA polymerase | 13:46 |
kanzure | or DNA polymerase | 13:46 |
fenn | so, the state of the logic gate's inputs are blobs of protein stuck to the dna, and the 'flow' is whether the gene is transcribed.. got it | 13:47 |
kanzure | right, because when you transcribe the gene, you're making the "output" of the gate, which then becomes the input to the next gate | 13:48 |
fenn | this is much simpler then :) | 13:48 |
kanzure | so I just need to write a DNA assembler. | 13:48 |
fenn | so you need a library of transcription factors and inhibitors | 13:49 |
fenn | that's your 'cache' | 13:49 |
kanzure | there are rules for making those library-items | 13:49 |
kanzure | so automatic generation of those is important | 13:49 |
kanzure | since you might have a circuit with a few thousand components | 13:49 |
kanzure | and you want your output going to the right place | 13:49 |
fenn | has that been proven in a lab? | 13:49 |
fenn | creating new transcription factors | 13:49 |
kanzure | yep, I'm pretty sure | 13:50 |
kanzure | http://www.dna.caltech.edu/DNAresearch_publications.html | 13:50 |
kanzure | see Construction of an in vitro bistable circuit from synthetic transcriptional switches. | 13:50 |
kanzure | it does not specifically imply that they have done this, but it is clear that they are using a mechanism so that logic does not 'jump' | 13:51 |
kanzure | also see Enzyme-Free Nucleic Acid Logic Circuits. | 13:51 |
kanzure | ah, shit: Protein Design is NP-Hard. | 13:52 |
fenn | you could do a combinatorial approach, tying known-to-work blobs together | 13:53 |
kanzure | wait, why do I want an assembler | 13:54 |
kanzure | an assembler works off of an ISA | 13:54 |
kanzure | and the ISA is for using the hardware | 13:54 |
kanzure | but we are writing the hardware, no? | 13:54 |
kanzure | this is confusing | 13:54 |
fenn | you want to generate the 'bitstream' i believe | 13:54 |
kanzure | ? | 13:54 |
fenn | which is where your netlist gets turned into hardware state | 13:54 |
fenn | in FPGA's there is some data which initializes the hardware into the state you want it to be (your circuit) | 13:55 |
fenn | it's called a bitstream | 13:55 |
fenn | VHDL/verilog describe the desired state in an abstract sense | 13:55 |
fenn | this gets turned into something made of slightly more concrete elements (logic gates and digital devices like flipflops) | 13:56 |
fenn | that's your xnf file | 13:56 |
kanzure | eh | 13:56 |
kanzure | let's modularize this | 13:56 |
kanzure | the basic output of this program should be a single logic gate | 13:57 |
kanzure | as in, the DNA | 13:57 |
kanzure | so, program xxdna should output DNA + information on "output specs" ... the parameter to xxdna should be (1) the logic gate needed and (2) the input-key that it should read (i.e., it | 13:57 |
can't just accept anything) | ||
kanzure | the space is limited obviously, so if you need 2^8 gates, you need something like 4 nucleotides for the 'key' | 13:58 |
kanzure | or something like that, 4^4 should be 2^8 | 13:58 |
kanzure | anyway, the input parameter to xxdna (the second parameter) should actually be a file name | 13:58 |
kanzure | and in this file we can store all of the input keys already used | 13:58 |
kanzure | so it just uses the next one | 13:58 |
fenn | it might be too hard to recognize DNA sequences, you will probably have to use combinations of proteins that bind together | 13:59 |
kanzure | and then it makes up its own output-key, which becomes the parameter for the next call to xxdna | 13:59 |
kanzure | nope, | 13:59 |
kanzure | as it turns out that's well studied | 13:59 |
kanzure | I need to go back and read the papers, but it looks pretty well studied | 13:59 |
fenn | ah that's good | 14:01 |
kanzure | I need to go find the algorithm. | 14:01 |
kanzure | because if I can find the algorithm | 14:01 |
kanzure | this is a very simple perl scripot | 14:01 |
kanzure | *script | 14:02 |
fenn | so you can just change the protein sequence to recognize a differen dna sequence? | 14:02 |
kanzure | no proteins involved | 14:02 |
fenn | oh? it's RNA transcription factor? | 14:02 |
kanzure | all mRNA strands :) | 14:02 |
kanzure | yep | 14:02 |
fenn | nice | 14:02 |
kanzure | protein folding is NP-hard, remember? hehe | 14:02 |
fenn | i think that's a myth, but i digress | 14:03 |
kanzure | it's a paper on their site | 14:03 |
kanzure | heh | 14:03 |
kanzure | the papers talk about a "toetail" which is what we want to algorithmically change | 14:05 |
kanzure | but they do not mention where this is in the actual sequence of the gates and so on | 14:05 |
kanzure | they give 8 different DNA sequences, I need to go back and map these out to what each of them are supposed to do | 14:06 |
kanzure | I have the sequences at the end of the page over here -- http://heybryan.org/winfree.html | 14:06 |
fenn | the output from the gate is tagged with the 'address' of the next gate | 14:11 |
kanzure | sort of, yes | 14:11 |
fenn | is there a 'packet diagram' somewhere or do they just list the raw sequences and hope you can read AGTAGAACCATAACACAAGGGTTCTCAAGAA | 14:14 |
kanzure | packet diagram? | 14:14 |
fenn | http://www.media.mit.edu/physics/publications/papers/04.10.sciam/barcode.jpg | 14:16 |
kanzure | ogh | 14:17 |
kanzure | heh | 14:17 |
kanzure | so in other words, a packet diagram of each of the DNA sequences | 14:17 |
kanzure | [this part should be changeable][READ ONLY!!] etc. | 14:17 |
fenn | right | 14:17 |
kanzure | --> The sequences of all DNA molecules and expected RNA transcripts | 14:20 |
kanzure | were chosen to minimize the occurrence of alternative secondary | 14:20 |
kanzure | structures, checked by the Vienna group’s DNA and RNA folding | 14:20 |
kanzure | program (Flamm et al, 2000). All DNA oligonucleotides were | 14:20 |
kanzure | purchased (Integrated DNA Technologies, Coralville, IA). T21-nt is | 14:20 |
kanzure | hmm | 14:20 |
kanzure | I guess I need that program | 14:20 |
fenn | flim flamm folding fun | 14:21 |
kanzure | Flamm's papers | 14:22 |
kanzure | http://www.tbi.univie.ac.at/~xtof/papers.html | 14:22 |
kanzure | Vienna RNA secondary structure server -- Hofacker 31 (13): 3429 ...The Vienna RNA package (12) is a free software package that implements a variety of ...... A. Weixlbaumer, A. Werner, | 14:22 |
C. Flamm, E. Westhof, and R. Schroeder ... | ||
kanzure | nar.oxfordjournals.org/ cgi/content/full/31/13/3429?ck=nck - Similar pages | 14:22 |
kanzure | (behind a paywall) | 14:22 |
kanzure | ah | 14:22 |
kanzure | RNAcofold | 14:22 |
fenn | it doesn't matter so much if you can't get the papers (if you have the source) | 14:23 |
kanzure | http://www.tbi.univie.ac.at/~ivo/RNA/ | 14:23 |
kanzure | haha, bitches! | 14:23 |
fenn | google ftw | 14:23 |
kanzure | actually :( http://en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software | 14:24 |
kanzure | `Finally, we provide an algorithm to design sequences with a predefined structure (inverse folding).` | 14:25 |
kanzure | http://rna.tbi.univie.ac.at/cgi-bin/RNAinverse.cgi <-- Web interface :) | 14:25 |
kanzure | so now I am confused | 14:27 |
kanzure | the RNA inverse input is not a nucleotide sequence | 14:27 |
kanzure | therefore RNA folds too? | 14:27 |
fenn | i think you want the other direction to figure out what those sequences do | 14:27 |
kanzure | you have to come up with a sequence in the first place | 14:28 |
fenn | rna and dna can fold up, depending on their sequence | 14:28 |
fenn | that web program takes a structure (a shape) and spits out a sequence that will give that shape | 14:28 |
kanzure | okay, then I want RNAup | 14:28 |
kanzure | The RNAup program for computing RNA-RNA interactions is now included. | 14:28 |
fenn | yes | 14:28 |
kanzure | so, if we want the logic gate to go through with the operation | 14:28 |
kanzure | the two RNA sequences must bind | 14:28 |
kanzure | or actually | 14:28 |
kanzure | the RNA output sequence (from the last gate) | 14:29 |
fenn | and relplot.pl | 14:29 |
kanzure | has to bind with the DNA | 14:29 |
kanzure | so this is RNA-DNA interaction | 14:29 |
kanzure | not RNA-RNA. | 14:29 |
fenn | you need both? the mRNA will interact with itself | 14:29 |
kanzure | huh? | 14:30 |
kanzure | that's true | 14:30 |
kanzure | so this is to check RNA-RNA interactions | 14:30 |
kanzure | oh | 14:30 |
kanzure | the RNA output has to bring in a sequence | 14:30 |
kanzure | that will complete the DNA for the next logic gate | 14:30 |
kanzure | so the RNA has to be able to "bring/tug/port" an oligonucleotide sequence over to the next logic gate | 14:30 |
kanzure | hm | 14:31 |
kanzure | I wonder if we can make it so that | 14:31 |
kanzure | yeah, it has to be made so that when the oligonucleotide sequence is wrong (the wrong key) the RNA does not deposit the oligonucleotides into the logic gate | 14:32 |
kanzure | because that would 'block' the logic gate | 14:32 |
fenn | one problem i can think of is sequence specificity.. a partly-mismatched 'address' will still bind somewhat | 14:34 |
kanzure | nope | 14:34 |
fenn | so you're still dealing with analog 'fuzzy' logic somewhat | 14:34 |
kanzure | I got it | 14:34 |
kanzure | DNA repair mechanisms | 14:34 |
kanzure | you have only one strand of the DNA logic gate there | 14:34 |
kanzure | and the RNA transcribers bring in the complement | 14:34 |
kanzure | yeah, wait a second | 14:35 |
kanzure | how do they unbind | 14:35 |
kanzure | or, why doesn't the DNA repair mechanisms just fill in the gaps | 14:35 |
kanzure | I think it's at "run time" where everything happens | 14:35 |
kanzure | so that only at run time, when the logic gate is being transcribed, is it on or off | 14:35 |
fenn | you lost me with the DNA repair stuff | 14:35 |
kanzure | well | 14:35 |
kanzure | I am now very confused | 14:36 |
kanzure | I was thinking that it may be using strand complements | 14:36 |
kanzure | for the on/off property | 14:36 |
kanzure | but that would mean that DNA repair mechanisms could just come in and add the right nucleotides and make it blocked | 14:36 |
kanzure | but I realize now that it has to be more "run time" than that | 14:36 |
kanzure | i.e., the actual magic happens during transcription | 14:36 |
fenn | this is complex.. | 14:36 |
kanzure | yes | 14:36 |
fenn | the dna structure exposes certain regions of DNA | 14:37 |
kanzure | no, it can't do that | 14:37 |
kanzure | because DNA repair guys would come around and fix it | 14:37 |
fenn | in a double helix | 14:37 |
kanzure | think of this: AATTGGTTT[where you need your gate output to fit]TTCCCATTGTAC and then this is attached to a complete compliment | 14:37 |
kanzure | the DNA proteins would fix the gap | 14:37 |
kanzure | therefore this is not how it works. | 14:38 |
fenn | everything's hunky dory, but 5% of the time (or whatever, depending on the binding strength of the DNA sequence) the double stranded structure comes apart and allows transcription factors | 14:38 |
to bind | ||
fenn | AT pairs are stronger than GC pairs | 14:38 |
kanzure | hm? | 14:38 |
fenn | it comes unzippered | 14:38 |
fenn | it's all jumbling around in a soup of brownian motion | 14:39 |
kanzure | yes | 14:40 |
fenn | so you can think of it like quantum mechanics, it's in suchnsuch state 20% of the time, | 14:40 |
kanzure | but I am having trouble parsing what you are saying | 14:40 |
fenn | the DNA repair mechanisms only detect certain types of structural abnormalities, they won't bind to partially open sequences like when it comes a bit unzippered | 14:40 |
fenn | when something 'binds' to a sequence, it's sometimes there and sometimes not there | 14:41 |
kanzure | oh | 14:41 |
kanzure | oh | 14:42 |
kanzure | also, | 14:42 |
kanzure | page 4 is good | 14:42 |
kanzure | Construction of an in vitro bistable circuit from synthetic transcriptional switches - bistable_switch2006.pdf | 14:42 |
kanzure | that's a lot of dense information | 14:45 |
kanzure | I need to diagram it or something | 14:45 |
kanzure | for some reason I keep on reading that paragraph over and over again, but it's not getting any better -- I think that they are giving the packet specification there, but I don't know how | 14:49 |
they figured out what sequence to put in it | ||
fenn | their diagram sucks | 14:49 |
fenn | oh boy the waveforms are plotted in hours | 14:51 |
kanzure | that's not good, is it? | 14:52 |
fenn | this is in vitro, it could mean anything | 14:54 |
fenn | http://en.wikipedia.org/wiki/List_of_RNA_structure_prediction_software#_note-book1 | 14:57 |
kanzure | ? | 14:57 |
fenn | i got confused.. just spent half of yesterday reading about the hitchhiker's guide | 14:58 |
kanzure | you've never read it? | 14:59 |
fenn | i've read it, but i've never read _about_ it | 14:59 |
kanzure | ah | 14:59 |
fenn | um, nevermind | 14:59 |
fenn | you shouldn't describe your dna/rna transcription circuits as using 'genes' since genes usually produce a protein and this gets confusing | 15:02 |
kanzure | hrm | 15:02 |
fenn | the ellington stuff on the other hand actually uses genes | 15:04 |
kanzure | here's the real Ellington stuff | 15:05 |
kanzure | http://ellingtonlab.org/mediawiki-1.10.0/index.php/Main_Page | 15:05 |
kanzure | hm | 15:06 |
kanzure | he has an amorphous computation guy | 15:06 |
fenn | not a very useful webpage | 15:08 |
kanzure | right | 15:08 |
fenn | i mean the transcription factors and gene products on this page are actually proteins http://heybryan.org/genetic-circuits.html | 15:09 |
kanzure | yes | 15:09 |
fenn | you will have to interface with proteins at some point in order to do sensing | 15:10 |
fenn | otherwise why bother running a biological computer? | 15:10 |
kanzure | that's okay | 15:10 |
kanzure | inhibition of circuits is possible | 15:10 |
kanzure | via the methods that were from genetic-circuits.html | 15:10 |
kanzure | i.e., a protein can prevent transcription | 15:10 |
kanzure | (inihibition) | 15:10 |
kanzure | dna.caltech.edu says -- | 15:11 |
kanzure | Software packages that we actively use for research, e.g. mfold, Vienna, Namot2, Tcl, RasMol..., as well as other software installed on our cluster, e.g. VMware, MATLAB, Mathematica, ... | 15:11 |
kanzure | huh | 15:18 |
kanzure | http://gcat.davidson.edu/GcatWiki/index.php/Logic_Gates_-_Emma_Garren | 15:18 |
kanzure | this might be good | 15:18 |
kanzure | also see Enzyme-free nucleic acid logic circuits - DNA_logic_circuits2006.pdf | 15:25 |
fenn | yes i'm reading that | 15:25 |
kanzure | I like how they conveniently exclude DNA sequences. | 15:26 |
kanzure | ooh | 15:35 |
kanzure | look at the bottom right-hand corner of the last page | 15:35 |
kanzure | the materials are on sciencemag.com | 15:35 |
kanzure | which I do not have access to. | 15:35 |
kanzure | woiah | 15:39 |
fenn | http://www.dna.caltech.edu/Papers/DNA_logic_circuits2006_supp.pdf | 15:39 |
kanzure | I got it | 15:39 |
kanzure | yeah, 18 pages | 15:39 |
kanzure | this is much easier to understand than the paper | 15:39 |
kanzure | page 16 for DNA. | 15:40 |
kanzure | Sequences were from: [S7] Lagos-Quintana, M., & Rauhut, R., & Yalcin, A., & Meyer, J., & Lendeckel, W., & Tuschl, T. (2002) Current Biology 12 735–739. | 15:41 |
kanzure | [S8] Lagos-Quintana, M., & Rauhut, R., & Meyer, J., & Borkhardt, A., & Tuschl, T. (2003) RNA 9, 175–179. | 15:41 |
kanzure | hm | 15:48 |
kanzure | it's interesting that they were using sequence optimization techniques | 15:48 |
kanzure | why not just generate a few megabyte file with a list of all possible sequences | 15:49 |
kanzure | for the lengths that they are working with | 15:49 |
kanzure | I am pretty sure they were using only the Flamm software packages. Maybe they will tell me if I ask nicely? | 15:49 |
fenn | 'sequence optimization' means getting rid of things that can go wrong, right? | 15:51 |
kanzure | yep | 15:51 |
kanzure | while also making sure the sequences meet requirements | 15:51 |
fenn | what would you do with a bunch of lousy sequences that probably wont work? | 15:52 |
kanzure | huh? | 15:52 |
kanzure | you want a list of things that *will* work | 15:52 |
kanzure | it's a toolset | 15:52 |
fenn | yes | 15:52 |
kanzure | so then xxDNA will just come in and select a few for the circuit that you are encoding into DNA. | 15:52 |
fenn | sure, 1 2 3 | 15:52 |
fenn | or maybe 5 6 7 | 15:52 |
kanzure | so save the effort and have a pre-generated list | 15:53 |
kanzure | generate once, use many | 15:53 |
fenn | what are the limiting factors? | 15:53 |
kanzure | minimization of secondary structures in single-stranded species | 15:53 |
kanzure | as predicted by the minimum-free-energy (MFE) structure [S3] at 25◦ C using DNA parameters [S4]; | 15:53 |
kanzure | minimization of cross-talk between all single-stranded species, as measured by the ∆G◦ of association between pairs of | 15:54 |
kanzure | strands (estimated as intramolecular MFE for a ‘virtual’ strand linking the two sequences via 5 unpaired nucleotides); | 15:54 |
fenn | i mean, you cant have a zillion different signals without paying for it somehow | 15:54 |
kanzure | right, so we'd constrain the generation-list to maybe length = 10 | 15:54 |
kanzure | which would be 4^10 possibilities, and then you narrow it down from there | 15:54 |
kanzure | by obviously avoiding certain sequences for testing heh' | 15:55 |
fenn | how did they calculate the 'delta-g of association' | 15:55 |
kanzure | for example | 15:55 |
kanzure | no clue | 15:55 |
kanzure | for example -- they say they don't want any 3 nt to be next to each other that are the same nt | 15:55 |
kanzure | so | 15:55 |
kanzure | that narrows it down significant | 15:55 |
kanzure | *significantly | 15:56 |
kanzure | I don't remember my number theory enough to be able to recall what that might look like | 15:56 |
fenn | number theory? just do a brute force method, it's only 4^10 possibilities :) | 15:56 |
kanzure | that's quite a lot :) | 15:56 |
fenn | only 1e12, and you only have to calulate the list once | 15:57 |
fenn | and a partial list is still useful | 15:57 |
kanzure | oh | 15:57 |
kanzure | only E12 | 15:57 |
kanzure | that's not bad | 15:57 |
kanzure | how much meta-information would be generated, after all? | 15:57 |
kanzure | only yes/no | 15:57 |
kanzure | and the actual sequence | 15:58 |
kanzure | so it's up to (number of bits required to express the strand + 1 bit for yes/no) * E12 | 15:58 |
fenn | not yes/no, you'd get a binding strength and a specificity value (standard deviation?) | 15:58 |
kanzure | you'd do the evaluation at runtime | 15:59 |
kanzure | and you'd just have to encode a "cut off point" for making the team or not ;) | 15:59 |
kanzure | *at generationtime (so runtime, but not runtime of xxdna) | 15:59 |
fenn | right? am i thinking this right? (4^10 different sequences)^2 | 16:00 |
kanzure | why's that? | 16:01 |
fenn | to compare each sequence against every other sequence | 16:01 |
kanzure | oh shit | 16:01 |
kanzure | that's not good | 16:01 |
kanzure | and yes, you're right | 16:01 |
fenn | 4^10 is about 1e6 | 16:01 |
kanzure | 4^10 is E12 | 16:01 |
fenn | no 4^10*4^10 = e12 | 16:01 |
kanzure | wait | 16:01 |
kanzure | okay | 16:01 |
kanzure | so | 16:02 |
kanzure | technically there would be subgroupings that can work together | 16:02 |
kanzure | but not with others | 16:02 |
kanzure | so for each sequence we would have to specify which ones they work with | 16:02 |
kanzure | maybe it would be optimal to do "groupings" | 16:02 |
kanzure | and then part of the "generation program" parameters would be "how many divisions do you want?" | 16:02 |
kanzure | and obviously you could do up to 4^10 divisions if you wanted to | 16:02 |
kanzure | or one division (making all results compatible) | 16:03 |
kanzure | *compatable | 16:03 |
fenn | i think 'how many divisions' is the 10 base pairs | 16:03 |
kanzure | I disagree | 16:03 |
kanzure | think about it: the first and last might be exclusive | 16:03 |
kanzure | but the first one and #14141 is good | 16:03 |
kanzure | so just because first-and-last are mutually exclusive, does that mean #1 and #14141 is bad? not at all | 16:03 |
kanzure | you just need to have some 'rules' or 'classifications' | 16:04 |
* fenn searches desperately for an analogy | 16:04 | |
kanzure | kind of like ethnic stereotypes | 16:04 |
kanzure | no asians and jews in the same room | 16:04 |
fenn | preferably something in a computer context | 16:04 |
kanzure | heh' | 16:04 |
kanzure | oh | 16:04 |
kanzure | either way, this idea sucks | 16:05 |
kanzure | lots of computation and simulation time is required | 16:05 |
fenn | i guess the sequence would have 'factors' which are the sub-sequences | 16:05 |
kanzure | that would make the task much less daunting | 16:06 |
kanzure | but I think it requires a simulation of their interaction | 16:06 |
fenn | like 0110 is 0011*2 (the 11 is a factor) | 16:06 |
kanzure | like, we can't just say "No AAA and TTTA" | 16:06 |
fenn | so what you're really combining is the sub-sequences, not the individual bases | 16:07 |
fenn | bleh | 16:07 |
kanzure | yeah ... | 16:08 |
kanzure | how did they do it, then? | 16:08 |
kanzure | did they just get lucky? | 16:08 |
fenn | small search space | 16:08 |
kanzure | ooh | 16:08 |
kanzure | no | 16:08 |
fenn | they only had 6 nt in the sequence | 16:08 |
kanzure | this is the inverse folding problem | 16:08 |
kanzure | so if you have specifications for a number of entities to inversely fold | 16:09 |
kanzure | you provide their stats and numbers | 16:09 |
kanzure | and then they come up with the sequences :) | 16:09 |
fenn | are we talking about the same thing? | 16:10 |
kanzure | yes | 16:10 |
kanzure | see | 16:10 |
fenn | i'm coming up with a 10 nt toehold sequence that should have low-cross talk | 16:11 |
kanzure | we were originally talking about generating a list of usable components | 16:11 |
kanzure | right | 16:11 |
kanzure | if we do it by generating nt seqs, then we have lots of processing to do | 16:11 |
kanzure | but we already know what we want the finished thing to be like | 16:11 |
kanzure | we don't care what its sequence is | 16:11 |
kanzure | as long as it interacts in the defined ways | 16:11 |
kanzure | this is basically why we have inverse folding =) | 16:11 |
fenn | ok | 16:11 |
kanzure | searching bottom-up (from possible nt seqs) would be much more computationally intensive | 16:12 |
fenn | isn't that how inverse folding works though? | 16:12 |
kanzure | there's energy minimization algorithms at work, I think | 16:13 |
kanzure | so that they constrain search space significantly | 16:13 |
fenn | i thought the energy minimization referred to the self-assembly of the structure, not the algorithm | 16:13 |
fenn | the structure assumes the minimal energy configuration | 16:14 |
kanzure | http://www.tbi.univie.ac.at/~ivo/RNA/RNAinverse.html | 16:14 |
kanzure | check out the options | 16:14 |
kanzure | oh | 16:14 |
kanzure | RNAinverse searches for seqs bruteforce | 16:15 |
kanzure | crap | 16:15 |
kanzure | http://freebirds.com/ | 16:17 |
kanzure | I'll be back later. | 16:17 |
fenn | if only they delivered via UAV | 16:18 |
kanzure | we can arrange that | 16:19 |
kanzure | they are ran by college students with nothing better to do | 16:19 |
kanzure | EUREKA | 16:22 |
kanzure | we'll do it in solution | 16:22 |
kanzure | screw computation | 16:22 |
kanzure | we just need a way to get rid of all of the sequences that have *not* binded | 16:22 |
kanzure | erm, woops | 16:22 |
kanzure | get rid of the ones that have bound together | 16:22 |
kanzure | i.e., maybe they are too heavy | 16:22 |
kanzure | and cannot be electrically attracted | 16:22 |
kanzure | to a certain anode | 16:22 |
kanzure | and then we just do DNA sequencing for all of the strands that *do* work | 16:22 |
* kanzure goes back to the shower ... | 16:23 | |
fenn | that's a lot of gels to run | 16:23 |
fenn | this reminds me of DNA microarrays | 16:33 |
fenn | anyway i'd rather a computer-based method as it is more easily replicated | 16:36 |
fenn | easily run on parallel clusters | 16:37 |
fenn | this is really cool http://www.dna.caltech.edu/Papers/DNAorigami-nature.pdf | 16:46 |
fenn | also the prospect of an FPGA from self-assembling tile sets (DNA/CNT hybrid structures) | 17:30 |
fenn | that's a straightforward path to a self-replicating computer | 18:17 |
fenn | presumably there would be a way to read the configuration data from some DNA into the FPGA's electronic circuitry | 18:18 |
-!- kanzure [n=bryan@cpe-70-113-54-112.austin.res.rr.com] | 18:20 | |
-!- ircname : purple | 18:20 | |
-!- channels : #gcc ##electronics #biology ##neuroscience #bioinformatics @#namcub #wrongplanet @##wikipeding | 18:20 | |
-!- server : irc.freenode.net [http://freenode.net/] | 18:20 | |
-!- away : Away | 18:20 | |
-!- : is identified to services | 18:20 | |
-!- End of WHOIS | 18:20 | |
kanzure | What would take longer? Simulation on a supercomputer, or using a solution and just mix them? Maybe we can use the DNA microarray idea, yes. DNA microarrays use mRNA probe tips to do | 18:25 |
hybridization, so if you detect an energy change you know there's been some binding. But this would only test one probe to the other sequences that you have in all of the wells. | ||
kanzure | But this would only test one probe to the other sequences that you have in all of the wells. | 18:25 |
fenn | if you're doing gel electrophoresis, the probes would all have to be different lengths or they won't separate | 18:35 |
kanzure | I prefer STM DNA sequencing. | 18:36 |
fenn | assuming you could detect a 1% difference in length (tough) how do you go about setting up the combinations? | 18:36 |
kanzure | DNA synthesizer. | 18:36 |
kanzure | giant inkjet printer ;) | 18:36 |
kanzure | that does oligosynthesis chemistry. | 18:37 |
fenn | crap STM sequencing was sci-fi last time i read anything about sequencing | 18:37 |
kanzure | heh | 18:37 |
kanzure | http://heybryan.org/mediawiki/index.php/DNA_sequencing | 18:37 |
kanzure | or sequencer or something | 18:37 |
kanzure | I have lots of notes on STM-DNA sequencing. | 18:37 |
kanzure | I also have a $100 STM design up there. | 18:37 |
kanzure | Huh. I think they are using a genetic algorithm to come up with the optimal sequences. | 18:56 |
kanzure | other side. Scores for each of these soft criteria were weighted and summed to obtain an overall score for the set of | 18:56 |
kanzure | sequences being designed. Sequence optimization proceeded by random descent to minimization of the overall score: | 18:56 |
kanzure | sequence mutations were made randomly (subject to satisfying the structural constraints) and accepted if the score | 18:56 |
kanzure | was reduced. If the final sequences were unsatisfactory, the scoring weights were adjusted, new initial sequences were | 18:56 |
kanzure | chosen, and optimization was attempted again. | 18:56 |
kanzure | Sounds like a GA to me. | 18:56 |
fenn | agreed | 18:57 |
kanzure | Okay. I got most of the requirements for the simulation. I just need to go get ref 3, 5, and 6. | 18:58 |
kanzure | http://heybryan.org/music/Yngwie%20Malmsteen%20-%20I%20Am%20a%20Viking.mp3 | 19:35 |
kanzure | Now just the Seeman ref. | 19:35 |
kanzure | well | 21:46 |
kanzure | that was interesting | 21:46 |
kanzure | Winfree offered me a spot. | 21:46 |
Day changed to 17 Mar 2008 | ||
kanzure | Hey. | 17:52 |
kanzure | So Winfree replied to my email and said that I should try looking for an analytical method of coming up with the RNA sequences. I have come up with the following formalization, I want | 17:52 |
you to take a look at it. | ||
kanzure | In any set N with 4^N different possible combinations, there are X specific "lonely RNA"s. In set N+1, the set X of specific "lonely RNAs" is not necessarily the new X subset of set N+1. | 17:54 |
If there's a general pattern in **which** sequences are "lonely RNAs" per each iteration, then we can do it analytically. | ||
kanzure | I just got done unfolding 24 hand-written pages of notes (on my own ideas, not school stuff) from my pocket. They are all from the last month or so. | 19:22 |
fenn | hands-down keyboard, keep it in your pocket | 20:01 |
fenn | http://en.wikipedia.org/wiki/Image:Septambic_key_numbering.jpg | 20:03 |
kanzure | Know anything about NMR? | 20:23 |
fenn | i know how it works | 20:25 |
fenn | wikipedia is probably a better source of info though :) | 20:25 |
fenn | ahh motherfucking irssi silently puts server notices like 'private messages are not allowed from unregistered users' into the server tab | 21:33 |
kanzure | heh | 21:33 |
fenn | http://en.wikipedia.org/wiki/Image:Septambic_key_numbering.jpg keep it in your pocket | 21:33 |
kanzure | Forget my NMR question. I would need E308 molecules. | 21:33 |
kanzure | There's only E77 atoms in the universe. | 21:33 |
fenn | d'eaux | 21:34 |
kanzure | I need to magically obtain a copy of matlab. Any suggestions? | 23:35 |
Day changed to 18 Mar 2008 | ||
fenn | iirc the demo is free | 00:41 |
fenn | then there's the pirate bay | 00:42 |
kanzure | indeed | 00:42 |
kanzure | http://www.youtube.com/watch?v=vimz7sz9Fx4&feature=related Star One - Space Metal - High Moon. | 00:42 |
fenn | or you could use Octave or Scilab | 00:42 |
kanzure | yep | 00:43 |
kanzure | I'm looking into Scilab. | 00:43 |
kanzure | http://shiriah.net/ayreon/Disc%201/07-Ayreon%20-%20Ride%20The%20Comet.mp3 | 01:18 |
kanzure | Find your way home, little extremophiles | 01:18 |
kanzure | Find your way home, donors of life | 01:18 |
kanzure | You're on your own, little extremophiles | 01:18 |
kanzure | You're on your own, cleaving the skies | 01:18 |
kanzure | [Chorus]: | 01:18 |
kanzure | Carry out our dangerous task | 01:18 |
kanzure | Sail uncharted spheres | 01:18 |
kanzure | Live out our dreams, ride the comet | 01:18 |
kanzure | Journey on the Migrator trail | 01:18 |
kanzure | Cross the new frontiers | 01:18 |
kanzure | Pass on our genes, ride the comet | 01:18 |
kanzure | relevant. | 01:18 |
fenn | a panspermian hymn? | 02:04 |
-!- kanzure: No such nick/channel | 02:04 | |
-!- There is no such nick kanzure | 17:20 | |
kanzure | There goes Arthur C. Clarke. | 18:49 |
Day changed to 19 Mar 2008 | ||
-!- fenn [n=pz@adsl-75-60-175-89.dsl.bltnin.sbcglobal.net] has quit [Read error: 110 (Connection timed out)] | 06:58 | |
-!- fenn [n=pz@adsl-76-251-87-108.dsl.bltnin.sbcglobal.net] has joined #hplusroadmap | 16:11 | |
[Users #hplusroadmap] | 16:11 | |
[ Enki-2] [ epitron] [ fenn] [ kanzure] | 16:11 | |
-!- Irssi: #hplusroadmap: Total of 4 nicks [0 ops, 0 halfops, 0 voices, 4 normal] | 16:11 | |
-!- Channel #hplusroadmap created Sat Mar 22 15:44:12 2008 | 16:11 | |
-!- Irssi: Join to #hplusroadmap was synced in 28 secs | 16:12 | |
kanzure | Hey fenn. | 17:04 |
kanzure | You get my email? | 17:04 |
fenn | yep | 17:06 |
kanzure | I don't think it's much of a problem | 17:06 |
kanzure | that it's a Hamiltonian cycle | 17:06 |
kanzure | but it just goes to show this will require lots of number crunching | 17:06 |
fenn | i looked it up and it didnt mean much to me | 17:07 |
kanzure | Oh, well, it's Traveling Salesman problem. | 17:07 |
kanzure | you have a guy that wants to go travel a path and wants to optimize his route | 17:07 |
kanzure | and hit up a few clients or whatever | 17:07 |
kanzure | there's an optimal path that gets all of the points | 17:07 |
kanzure | but this can't be solved in polynomial deterministic time or something | 17:07 |
kanzure | http://en.wikipedia.org/wiki/Traveling_Salesman | 17:08 |
kanzure | NP-hard ;) | 17:08 |
fenn | i hope the database isnt complex enough that it will take a computer very long | 17:08 |
kanzure | this depends on what we want to do | 17:09 |
kanzure | do we want to (1) hand-code all connections between packages? | 17:09 |
kanzure | or (2) let the computer figure out possible connections between packages? We can program in "matter/energy converters" - since all mechanical energy can become chemical energy, etc. | 17:10 |
kanzure | #1 means we will probably know it all so that we will know if something seems stupid | 17:10 |
kanzure | but by #1 we may miss stuff | 17:10 |
kanzure | by #2 we get lots of bloat, longer search time, and maybe not a 'reduced' graph (although it will give us the general idea) | 17:10 |
fenn | #2 seems very difficult | 17:11 |
kanzure | maybe not -- just code in modules for each type of variable to interact with each other | 17:11 |
fenn | not impossible, but crikey, it's like the holy grail of automated engineering | 17:11 |
kanzure | just like in C++ where you have to define how the + operator interacts with other classes for a certain object | 17:11 |
kanzure | haha | 17:11 |
kanzure | yes, I suppose that's true. | 17:11 |
fenn | now i've had people say stuff like that to me all the time, and it doesnt necessarily mean anything | 17:12 |
kanzure | the holy grail stuff? | 17:12 |
fenn | after all we have gigahertz computers with gigabytes of ram and terabytes of storage | 17:12 |
kanzure | that's true | 17:12 |
kanzure | and not all of it has to be 'simulated' with physics and so on | 17:12 |
kanzure | it's really just testing out how to put legos together | 17:12 |
fenn | and still using the same software from the 1980's for most CAD/CAE stuff | 17:12 |
kanzure | it's like having a giant bucket of legos | 17:13 |
kanzure | but these legos don't all connect | 17:13 |
kanzure | hrm, the lego analogy doesn't work I think | 17:13 |
kanzure | since they are not functional-legos | 17:13 |
fenn | its like trying to use your SCSI tape reader to play video on the VCR | 17:13 |
kanzure | hah | 17:13 |
kanzure | I don't think so. What happened to the dependency-loop ideas and so on ? | 17:14 |
fenn | and then record computer backup data onto a video tape | 17:14 |
fenn | well the interesting thing about a dependencey loop is it's sort of a mini exponential growth without self replication | 17:15 |
kanzure | Oh, Wikipedia is correcting me. It's not a Hamiltonian cycle. Just a closed path. | 17:16 |
kanzure | hm? | 17:16 |
fenn | "i'm fat because i eat so much, i eat because i'm depressed, i'm depressed because i'm fat. it's a vicious cycle that took years to perfect." -garfield the cat | 17:16 |
kanzure | closed cycle, actually (cycle means path, except the path ends/begins at same vertice) | 17:16 |
kanzure | I remember that one :) | 17:16 |
kanzure | so, the only reason why we need skdb and the solver is really just because we can't come up with a 2-module system that makes itself, really. A sand-processor that makes a | 17:18 |
glass-processor, and the glass-processor makes the sand processor (but this doesn't make sense). | ||
kanzure | and as you fill out the requirements, it is kind of like exponential growth | 17:18 |
kanzure | since the more you need, the more components you have to add | 17:18 |
kanzure | that's why I like starting with a part already -- an arm, say | 17:18 |
kanzure | and then we add components to the arm until it is able to self-replicate | 17:18 |
fenn | also i was thinking about symbiosis, where you have not one single point through which the loop passes, but more like several interconnected loops in parallel | 17:18 |
kanzure | like the character '8' ? | 17:19 |
fenn | more like a knitted headband | 17:19 |
kanzure | like oooooooooo | 17:19 |
kanzure | hm | 17:19 |
kanzure | xxxxxxxxxx ? | 17:19 |
kanzure | but those cross | 17:19 |
fenn | http://fennetic.net/pub/irc/directed_cyclic.png | 17:22 |
kanzure | that's hard to understand | 17:23 |
kanzure | could you color the cycles? | 17:23 |
fenn | a b c are the replicators | 17:23 |
kanzure | the entire design? | 17:23 |
fenn | alone they couldnt replicate | 17:24 |
kanzure | why is there two sets of a, b, c ? Showing the replication? | 17:24 |
fenn | just to connect the top and bottom | 17:24 |
kanzure | I'm sort of thinking there should be more symmetry here | 17:25 |
kanzure | The requirements: | 17:27 |
kanzure | A+B = C | 17:27 |
kanzure | A + C = B | 17:27 |
kanzure | B + C = A | 17:27 |
fenn | ok reload. the green are new copies of the red ABC, but their position in the graph is identical | 17:27 |
fenn | the purple is a leaf node, unrelated to replication (but requires b and c) | 17:28 |
kanzure | B + C looks required for replication | 17:28 |
kanzure | but not the purple one, right | 17:28 |
kanzure | aren't these supposed to be directed? | 17:29 |
fenn | yesmeh | 17:29 |
fenn | dia is a pain to use | 17:30 |
kanzure | this is dia? | 17:30 |
kanzure | haha | 17:30 |
fenn | no, that's kolourpaint | 17:30 |
kanzure | hehe | 17:30 |
fenn | i added numbers | 17:32 |
fenn | you might say that node 6 or node 7 is "the" replicator | 17:32 |
kanzure | What about 5? | 17:33 |
fenn | hmm how do you show in graph theory that you must approach a vertex from two edges at the same time? | 17:35 |
kanzure | that's interesting | 17:35 |
kanzure | draw arrows with matching colors? | 17:35 |
kanzure | lemme ask #math | 17:35 |
fenn | 7 should depend on 5 and 6 being present | 17:36 |
fenn | i added 9, which depends on 5 and 8 | 17:37 |
fenn | i'm sure this could be simplified | 17:38 |
kanzure | a "required vertice" is interesting | 17:38 |
kanzure | required vertices | 17:38 |
kanzure | it's a functional graph, in a sense | 17:38 |
kanzure | so you just have to say that "vertice X does not exist without vertice Y" | 17:38 |
fenn | well, it might exist, but you can't get to it | 17:38 |
fenn | like, i might have a lathe and bar-stock, but no cutting bits | 17:39 |
fenn | ok poor example | 17:41 |
kanzure | maybe you need two graphs | 17:43 |
kanzure | one for the dependencies and then one for the vertice dependencies | 17:44 |
kanzure | or something like that | 17:44 |
fenn | earlier i was talking about different graphs for streams and packages (run-time and build-time, respectively) | 17:44 |
fenn | but you can also have a package that makes packages | 17:45 |
fenn | or streams that spontaneously degrade into something | 17:45 |
kanzure | hm | 17:49 |
kanzure | so then you have to figure out a way to specify the extra requirements for the graph then | 17:50 |
fenn | gosh math is really useless sometimes | 18:02 |
kanzure | reading up on Wikipedia? | 18:02 |
fenn | "the sum of all the vertex-degree is equal to twice the number of edges" | 18:03 |
kanzure | the vertex-degree is something like the number of connections | 18:04 |
kanzure | to a certain vertice | 18:04 |
fenn | yep | 18:04 |
fenn | since a line connecting the vertices has two end points, there are 2*lines number of endpoints | 18:05 |
fenn | big deal | 18:05 |
kanzure | haha | 18:06 |
kanzure | =) | 18:06 |
kanzure | fenn, what exactly are you looking into at the moment? | 18:20 |
fenn | strange loops and graph theory | 18:28 |
kanzure | mind pasting anything you find interesting ? | 18:31 |
fenn | In 1974 the Consumer Product Safety Commission recalled 80,000 of its own lapel buttons promoting toy safety. The buttons had paint with too much lead, sharp edges, and clips that could be | 18:35 |
broken off and swallowed. | ||
kanzure | huh? for graph theory? | 18:37 |
kanzure | hehe | 18:37 |
fenn | apparently irony is self-referential | 18:38 |
kanzure | didn't know? | 18:41 |
fenn | this looks about right: http://www.graphviz.org/Gallery/directed/fsm.html | 19:09 |
kanzure | neat. | 19:09 |
fenn | i really want something more interactive though | 19:11 |
kanzure | to what extent? | 19:11 |
fenn | to be able to poke at the graph and rearrange it.. as if the vertices were connected by springs | 19:13 |
kanzure | yes, I have wanted an interactive interface to graphviz for a while now | 19:14 |
kanzure | there's "freemind" out there on SF, it's sort of node-based but only for concept-maps, and it's all in java | 19:14 |
kanzure | so it's kind of disgusting. | 19:14 |
fenn | someone i know wrote a java app that did springy networks (FEA - he's an engineer) | 19:16 |
fenn | this should be pretty easy to write from scratch in whatever language | 19:16 |
kanzure | finite element analysis? | 19:18 |
kanzure | hm | 19:18 |
kanzure | but hacking graphviz is not so easy, last I checked | 19:19 |
kanzure | they had lots of literature that you have to sort through, you need to have connections to get the papers | 19:19 |
kanzure | maybe I'm wrong, it's worth investigating | 19:19 |
fenn | i need to write a similar application for emc2 actually | 19:20 |
fenn | graphical hal configurator | 19:20 |
fenn | this is neat http://www.kylescholz.com/projects/speaking/tae2006/music.fm/ | 19:25 |
kanzure | ooh | 19:28 |
kanzure | it looks pretty close | 19:29 |
fenn | the neat part is the search results are actually right | 19:30 |
fenn | you can drag the names around if you select them | 19:33 |
fenn | The main plastic we are using is polylactic acid. Anyone can make this by fermenting starch, so if you have a few tens of square meters of land to grow a starch crop you not only have a | 19:38 |
self-reproducing machine, you have a self-reproducing source of feedstock independent of the petrochemical industry. | ||
kanzure | reprap? | 19:41 |
fenn | yes | 19:47 |
kanzure | fenn: so what should the next steps be? any thoughts? | 21:29 |
kanzure | I think we need to formalize your graph-definition and make a program to generate expandable graphviz files that follow the format | 21:29 |
fenn | file format and parser | 21:34 |
fenn | needs to be text based, human and machine readable | 21:35 |
fenn | i'm thinking about yaml or slip-xml | 21:35 |
kanzure | maybe we can write the parser in flex/bison to convert to graphviz format for the data visualization | 21:41 |
kanzure | erm, I think I am cutting a few steps in the toolchain | 21:42 |
Enki-2 | just use flex alone | 21:43 |
Enki-2 | bison isn't needed if you know flex | 21:43 |
kanzure | right, but the file format would not necessarily be what we want to see a graph of | 21:46 |
Enki-2 | i mean, flex can do translation of formats on its own, sans bison | 21:46 |
Enki-2 | i've done complete compilers in flex | 21:47 |
kanzure | woah, you're not fenn | 21:47 |
kanzure | just realized this :) | 21:47 |
Enki-2 | :P | 21:47 |
fenn | i dont know flex or bison, so i'm going to do a naive straightforward implementation :) | 22:18 |
kanzure | bison is extremely easy | 22:19 |
kanzure | http://dinosaur.compilertools.net/bison/bison_6.html | 22:19 |
kanzure | http://www.gnu.org/software/bison/ | 22:19 |
kanzure | http://cs.wwc.edu/~aabyan/464/Book/ | 22:19 |
kanzure | This one is really good - http://www.garshol.priv.no/download/text/bnf.html | 22:20 |
kanzure | short and to the point | 22:20 |
fenn | OT: just in the shower, thinking about cost of inventory space. A package's inventory complexity has to do with the number of unique items that need to be stored, their overall shape, and | 22:20 |
the size. Each physical object can be given metrics based on its bounding shape (i.e. cube cylinder sheet rope sphere amorphous) | ||
kanzure | inventory could be external for simple designs | 22:20 |
fenn | this cost comes out of human attention (our most precious commodity) unless there is an automated inventory system | 22:21 |
kanzure | Uh oh. News on http://utexas.edu/ (where I'm going next year) -- `BB&T gives $2 million for Ayn Rand researchPhilosophy Department to create new chair for study of novelist’s philosophy | 22:21 |
of Objectivism.` Oh boy. | ||
fenn | i take it that's bad? | 22:22 |
kanzure | Objectivisim is a word-hijack | 22:22 |
kanzure | it means lots of politics and capitalism | 22:22 |
kanzure | generally not good philosophy | 22:22 |
fenn | what does politics and capitalism have to do with philosophy? | 22:22 |
kanzure | Ayn Rand :( | 22:22 |
fenn | oh, objectivism is at least slightly different from objectivity | 22:23 |
kanzure | http://en.wikipedia.org/wiki/Objectivism_(Ayn_Rand) | 22:23 |
fenn | in terms of word structure | 22:23 |
kanzure | ` ... that the proper moral purpose of one's life is the pursuit of one's own happiness or "rational self-interest"; that the only social system consistent with this morality is full | 22:23 |
respect for individual rights, embodied in pure, consensual laissez-faire capitalism; ` | ||
kanzure | the Proper Moral Response | 22:23 |
kanzure | *Purpose | 22:23 |
fenn | if they can implement capitalism through a university philosophy department, more power to them :\ | 22:24 |
kanzure | heh | 22:24 |
fenn | as i see it, capitalism was demolished by corporations and the patent system | 22:24 |
fenn | or at least the prospect of it becoming a reality | 22:25 |
kanzure | fenn: in general, I am not communist, I am not capitalist, I am not anything like that at all -- I think that these old 'socioeconomic philosophies' need to be dismantled and replaced | 22:26 |
with a more intense, rigorous mathematical framework where we don't have bullshit "Social Contracts" etc. | ||
fenn | how can you have patents and call it capitalism? nonsense | 22:26 |
kanzure | these old ideas are *ancient* | 22:26 |
kanzure | technological development is accelerating | 22:26 |
kanzure | perhaps when we had a constant rate of development, capitalism/communism/Objectivism/Christianity/Republicanism worked, but the world just isn't the same | 22:26 |
kanzure | these are all old, stale ideas with a massive number of people still promoting them | 22:27 |
kanzure | and while there are good ideas within, | 22:27 |
kanzure | the culture is still largely one of identification and not of ... importing the good ideas ;) | 22:27 |
fenn | indeed | 22:27 |
fenn | let it be known i'm not a sports fan | 22:27 |
kanzure | hah =) | 22:27 |
fenn | got any opinion on this? http://www.debian.org/social_contract | 22:28 |
kanzure | oh-my-god I have access to scientific databases | 22:29 |
fenn | you mean journals? | 22:29 |
kanzure | yes | 22:30 |
* kanzure hugs his UT login | 22:30 | |
fenn | gratz. got ieee spectrum access? | 22:30 |
kanzure | fenn: Not anything off the top of my head. | 22:30 |
kanzure | fenn: yes | 22:30 |
fenn | sweet | 22:30 |
kanzure | fenn: I just opened up an article on pyroelectricity | 22:30 |
kanzure | Piezoelectricity and Pyroelectricity in Polymers | 22:31 |
kanzure | First legally accessed, paywalled scientific paper | 22:31 |
kanzure | this should go in my baby book or something | 22:31 |
fenn | today is something special.. i forget | 22:32 |
kanzure | there was chocolate today | 22:32 |
kanzure | so I'd venture a guess of easter | 22:32 |
fenn | aha | 22:32 |
fenn | right, we had jehova's witnesses | 22:33 |
fenn | (not for dinner) | 22:33 |
fenn | international bunny day - day of the replicator! | 22:33 |
-!- fenn changed the topic of #hplusroadmap to: happy bunny day - day of the replicator! | 22:34 | |
kanzure | epitron: I'll be adding a 50 MB zip file to the server later tonight. | 22:36 |
kanzure | woot, nature! | 22:38 |
kanzure | American Physical Society ! | 22:39 |
kanzure | fenn: I want to write a script to browse through Google Scholar. Any thoughts? I want the input to be a list of papers, and an output to be a nice package of PDFs. | 22:54 |
kanzure | Google does not provide a direct interface to a PDF for a title you enter: some of the links it returns may or may not be to a PDF. | 22:55 |
kanzure | so in the cases where this does not happen, you can go through whatever journal website there is and click on a link that says "PDF" | 22:55 |
fenn | if (grep '<a href=".*\.pdf">'): wget $1; else ... ? | 22:59 |
fenn | note that was pseudo-code | 22:59 |
kanzure | nah, | 23:02 |
kanzure | the url doesn't necessarily have .PDF in it | 23:02 |
kanzure | but you can scan for PDF next to the link | 23:02 |
kanzure | there's a way to process Google pages, they have a nice systematic format with div tags and so on | 23:02 |
kanzure | I need to go look at the HTTP libraries to see if there's some way to log in with cookies to a service | 23:02 |
kanzure | WWW:Mechanizer might be what I want. | 23:03 |
fenn | you need to get those cookies though, which might not be straightforward with a non-browser interface | 23:03 |
kanzure | ooh | 23:04 |
kanzure | WWW::Mechanize does something interesting though | 23:04 |
fenn | especially since scientific publishers arent known for their browser compatibility | 23:04 |
kanzure | use WWW::Mechanize; | 23:04 |
kanzure | use HTML::TokeParser; | 23:04 |
kanzure | my $agent = WWW::Mechanize->new(); | 23:04 |
kanzure | $agent->get("http://www.radiotimes.beeb.com/"); | 23:04 |
kanzure | $agent->follow("My Diary"); | 23:04 |
kanzure | $agent->field("email", $email); | 23:04 |
kanzure | $agent->click(); | 23:04 |
kanzure | so in other words it's like doing the physical actions | 23:04 |
kanzure | except there's no browser UI | 23:04 |
kanzure | Okay, first part done. Neat. | 23:10 |
kanzure | Hm, the rest is testing my knowledge of regexps. I want to extract the first link after <b>[PDF]</b>. | 23:19 |
fenn | $agent->follow("[PDF]") right? | 23:20 |
kanzure | if the name of the link was [PDF], yes | 23:21 |
kanzure | but PDF is not part of the link name | 23:21 |
kanzure | it's just 'near' it | 23:21 |
fenn | unless you want to do something like ~= <b>\[PDF\]</b>.*<a href="(.*)"> | 23:21 |
kanzure | so I'm thinking of splitting up the string | 23:21 |
kanzure | exploding it just before [PDF] | 23:21 |
kanzure | and then after the next </a> | 23:21 |
fenn | oh, 'follow' means click on the link | 23:21 |
kanzure | right | 23:21 |
kanzure | will your regexp work? | 23:22 |
kanzure | $1 would be my url, right? | 23:22 |
fenn | ~= '<b>\[PDF\]</b>.*<a href="(.*)">(.*)</a>' $1 is the url $2 is the link text | 23:22 |
kanzure | <td valign=top><p class=g><span class="w"><font size=-2><b>[PDF]</b></font> <a href="http://www.stat.yale.edu/~jtc5/GeneticNetworksGroup/GibsonAndBruck2000.pdf" onmousedown="new | 23:23 |
Image().src='/scholar_url?sa=T&url=http://www.stat.yale.edu/~jtc5/GeneticNetworksGroup/GibsonAndBruck2000.pdf';"><b>Efficient exact stochastic simulation </b>of <b>chemical systems | ||
</b>with <b>many species </b>and <b>many channels</b></a></span> - <a | ||
kanzure | <b>Species</b> and <b>Many</b> <b>Channels</b> Michael A. Gibson* and Jehoshua <b>...</b> | 23:23 |
kanzure | anyway, it gets nasty | 23:23 |
kanzure | so you can't assume it's <a href=""> precisely | 23:23 |
kanzure | hm, it's kind of smart with the "on-mouse-down" function | 23:24 |
kanzure | but that's no problem - that's what the follow() idea is, no? :) | 23:24 |
kanzure | or the "click" hehe | 23:24 |
fenn | it gives the url in the <a href=" | 23:25 |
kanzure | ooh | 23:25 |
kanzure | yes, but | 23:25 |
kanzure | look at what they do, they have this: | 23:25 |
kanzure | <a href="http://www.stat.yale.edu/~jtc5/GeneticNetworksGroup/GibsonAndBruck2000.pdf" onmousedown="new | 23:25 |
Image().src='/scholar_url?sa=T&url=http://www.stat.yale.edu/~jtc5/GeneticNetworksGroup/GibsonAndBruck2000.pdf';"> | ||
fenn | you want to ignore that? or what? | 23:25 |
kanzure | <a href="xxx" onmousedown="xxx"> | 23:26 |
kanzure | erm | 23:26 |
kanzure | <a href="xxx" onmousedown="yyy"> | 23:26 |
kanzure | where we want the xxx, and then after the yyy"> we can get the title | 23:26 |
fenn | ~= '<b>\[PDF\]</b>.*<a href="(.*)" onmousedown="(.*)"' $1 is the url $2 is the onmousedown | 23:26 |
kanzure | do I have to say $var ~= ... ? | 23:27 |
-!- Enki-2 [n=weechat@c-71-234-190-248.hsd1.ct.comcast.net] has quit [Read error: 104 (Connection reset by peer)] | 23:27 | |
fenn | $var should be the whole document i think | 23:27 |
kanzure | ah, right | 23:27 |
kanzure | okay | 23:27 |
fenn | ~= loads all that crap into special variables | 23:27 |
fenn | did i mention i hate perl? :) | 23:27 |
kanzure | hehe | 23:28 |
fenn | oh joy they use single quotes in the url | 23:29 |
kanzure | hm? | 23:31 |
-!- Enki-2 [n=weechat@c-71-234-190-248.hsd1.ct.comcast.net] has joined #hplusroadmap | 23:34 | |
kanzure | $searchresults ~= '<b>\[PDF\].*<a href="(.*)" onmousedown="(.*)">(.*)</a>'; | 23:35 |
kanzure | parse error | 23:35 |
kanzure | hm | 23:36 |
fenn | ah i knew it would be something stupid | 23:41 |
fenn | =~ not ~= | 23:41 |
fenn | http://fennetic.net/pub/irc/test.pl | 23:43 |
kanzure | hahaha | 23:49 |
kanzure | this is awesome | 23:49 |
fenn | i wish they would have used a different operator | 23:50 |
kanzure | epitron, fenn -- Cosmic coincidences ;) http://heybryan.org/shots/2008-03-23_autoscholar.png | 23:51 |
fenn | who is eugen? | 23:52 |
kanzure | I've never talked about him? | 23:52 |
kanzure | http://eugen.leitl.org/ see for yourself | 23:52 |
kanzure | he's also mentioned here - http://heybryan.org/stats/2008-03-23-extropy-chat.html | 23:52 |
kanzure | he's also mentioned on http://heybryan.org/mediawiki/index.php/Roadmap | 23:52 |
kanzure | http://heybryan.org/mediawiki/index.php/Getting_up_to_speed too (I think) | 23:53 |
fenn | more like synthetic serendipity ;) | 23:53 |
kanzure | Eugen Leitl is sort of a polymath. | 23:54 |
kanzure | Good guy to know. | 23:54 |
fenn | many a time i've come across chat logs of me asking the same question i was googling for | 23:54 |
kanzure | I was talking on a mailing list one day about how you should just "do the transhumanism thing and be done with it, ignore politics - once you transcend, they can't stop you." He replied | 23:54 |
within 30 seconds and said "Yes, but now that they know what you are up to, they could stop you *now*." He and I have known each other ever since. | ||
kanzure | same here | 23:54 |
fenn | well, what do you do about that? | 23:55 |
kanzure | hide | 23:55 |
kanzure | but I have been a moron and am already on the net | 23:55 |
kanzure | in fact, there's a very significant portion of content generated by me on the net | 23:55 |
kanzure | heh | 23:55 |
fenn | hm.. secrecy doesn't work | 23:55 |
kanzure | right | 23:55 |
kanzure | it seems that the best way to go about it is to just be open as much as possible | 23:56 |
fenn | better to make yourself indispensable | 23:56 |
fenn | and dont get involved in shady criminal activities as a hobby | 23:56 |
fenn | because then there's a reasonable excuse for your mysterious disappearance | 23:56 |
kanzure | secretly, I was a script kiddie when I was 11 | 23:56 |
fenn | there werent any scripts when i was 11 :( | 23:57 |
kanzure | old fart | 23:57 |
fenn | i'm not that old (25) | 23:57 |
kanzure | okay, so the script is mostly working | 23:57 |
kanzure | it gets the wrong URL though | 23:57 |
kanzure | it gets the stuff after a href=" but then doesn't stop at the first " | 23:58 |
kanzure | $searchresults =~ '<b>\[PDF\]</b>.*<a href="(.*)" onmousedown="(.*)">(.*)</a>'; | 23:58 |
kanzure | so I need those quotation marks to match exactly | 23:58 |
fenn | oh, probably greedy vs non-greedy matching | 23:58 |
kanzure | should I add /g to the end? | 23:59 |
kanzure | or /ig ? | 23:59 |
fenn | g is global? | 23:59 |
kanzure | oh | 23:59 |
kanzure | hrm | 23:59 |
fenn | (.*?) i think | 23:59 |
kanzure | oh | 23:59 |
kanzure | no, | 23:59 |
kanzure | =~ m/stuff/; | 23:59 |
Day changed to 24 Mar 2008 | ||
fenn | not following you | 00:00 |
kanzure | nope, that didn't work | 00:00 |
kanzure | you're right | 00:01 |
kanzure | wget --output-file is not useful | 00:03 |
kanzure | it just routes the wget output to that file | 00:04 |
kanzure | not the downloaded file | 00:04 |
fenn | --output-document | 00:05 |
kanzure | Alright, neat. Now I need to figure out a way to fetch a document if there is no PDF available. | 00:06 |
kanzure | So, in the case where there is not a PDF available, there's usually a link that says "All $number versions >>" and then on the following page there's a list of possible places to get | 00:08 |
it, where we can do the PDF-search thing again, *or* click on a link that says " Get this article" which takes the user to a page where there's a Javascript "Go" button to get the | ||
fulltext from various databases (obviously, select the first one). But | ||
fenn | But (EOL) | 00:09 |
kanzure | eh | 00:11 |
kanzure | at this point it takes you to Nature, or some other database, and on that page the only thing you can hope to do is search for the link with a name including "PDF" and just get that URL. | 00:11 |
kanzure | this seems pretty simple in comparison | 00:11 |
kanzure | if javascript execution works | 00:12 |
fenn | does WWW::Mechanise run javascript? | 00:12 |
kanzure | asking #perl atm | 00:12 |
kanzure | ah, shit, no | 00:13 |
kanzure | http://search.cpan.org/dist/WWW-Mechanize/lib/WWW/Mechanize/FAQ.pod | 00:13 |
fenn | I don't use JavaScript myself, so I don't have an itch to scratch. <- wtf does he use WWW::Mechanize for then? | 00:14 |
kanzure | hahah | 00:16 |
fenn | read 'So what can I do?' - is the url in the html source somewhere? (even if its not standard) | 00:16 |
kanzure | yes, I figured I'd have to do that anyway | 00:17 |
kanzure | and it turns out it's pretty simple in this case | 00:17 |
kanzure | it's just a form call hehe | 00:17 |
fenn | is it the same from publisher to publisher? | 00:17 |
kanzure | http://p9003-www.lib.utexas.edu.ezproxy.lib.utexas.edu/sfx_local/cgi/core/sfxresolver.cgi?basic1&tmp_ctx_obj_id=1&service_id=110974981369254&request_id=4760844 <-- will redirect me to | 00:18 |
the first "full text" available option ... but not directly to the PDF. And service_id and request_id have to be extracted from the page (they are hidden form fields) | ||
fenn | i think 'socialized eng kdb' should be changed, because 'socialized' actually means something rather different | 00:23 |
fenn | socio-economic system in which property and the distribution of wealth are subject to control by the community | 00:23 |
fenn | but you mean, distributed development and distributed knowledge right? | 00:24 |
kanzure | right | 00:24 |
kanzure | socialized knowledge as in, "social knowledge" | 00:24 |
kanzure | social as in "community-known" | 00:24 |
kanzure | but I'm good for a change | 00:24 |
fenn | societal engineering knowledge db? | 00:27 |
kanzure | sure | 00:27 |
kanzure | hm, it turns out I need only search for either (1) PDFs or "Get this article" links on the Google Scholar search results page | 00:29 |
kanzure | my local "should be a programmer but isn't yet" buddy just sent me this: http://www.osnews.com/images/comics/wtfm.jpg | 00:31 |
kanzure | Bill: so like apt-get but for science journals | 00:33 |
kanzure | smart guy too | 00:33 |
fenn | heh. good for ui testing at least | 00:34 |
kanzure | Java.swing :( | 00:35 |
kanzure | I will never again use java swing | 00:35 |
kanzure | ever | 00:35 |
fenn | but what about the cool sketch-on-a-napkin skin? | 00:36 |
kanzure | hm? | 00:36 |
kanzure | xkcd ref? | 00:36 |
fenn | http://napkinlaf.sourceforge.net/ | 00:36 |
fenn | good for a laf at least :) | 00:37 |
kanzure | har har | 00:38 |
kanzure | fenn: does .* have to match anything? | 01:00 |
fenn | please restate the question in the form of an answer | 01:00 |
kanzure | hm | 01:00 |
fenn | .* means any character, any number of times | 01:00 |
kanzure | see, I want to now match for <a href="(.*?)"(.*?)>.*PDF.*</a> | 01:01 |
kanzure | so that I get the URL to links that have 'PDF' in their name | 01:01 |
fenn | </a> might belong to a url that is later in the file | 01:01 |
kanzure | hrm | 01:01 |
kanzure | okay | 01:01 |
kanzure | so I guess I can do (.*?) still | 01:02 |
fenn | so i think the second .* should be .*? | 01:02 |
kanzure | <a href="(.*?)"(.*?)>.*PDF.*?</a> | 01:02 |
fenn | yes | 01:02 |
kanzure | I don't really need the second (.*?) | 01:02 |
kanzure | <a href="(.*?)".*?>.*PDF.*?</a> | 01:02 |
fenn | () just changes what gets stored in special variables | 01:02 |
kanzure | right | 01:02 |
kanzure | so I just need the href variable | 01:02 |
fenn | (in this example) | 01:03 |
fenn | uh, it might be a bit late to mention that there are probably lots of xml or html parsing tools | 01:03 |
kanzure | I was looking into them | 01:03 |
kanzure | the perl community is obsessed with LinkExtor | 01:04 |
kanzure | but it does not return the link name | 01:04 |
kanzure | and for some reason I didn't think to go more generalized with XML | 01:04 |
fenn | i think you need ? on all the .*'s | 01:05 |
kanzure | if () { /* stuff * / } else if ($searchresults =~ /Get this article/) { } <--- parse error at } else if () { ........ wtf? | 01:08 |
fenn | / get this article/ probably has a / in it somewhere | 01:10 |
fenn | you can use other characters to bound the regexp | 01:10 |
kanzure | ah, it was something else entirely | 01:11 |
kanzure | how ridiculous | 01:14 |
fenn | how Perl | 01:14 |
kanzure | my password, I have to pass it to wget with --proxy-pass | 01:14 |
kanzure | and it has a bang in it | 01:14 |
kanzure | for some reason | 01:14 |
kanzure | and this messes up bash | 01:14 |
kanzure | apparently I can't escape it | 01:14 |
kanzure | with \! | 01:14 |
fenn | !! i think | 01:14 |
kanzure | ugh | 01:14 |
fenn | no that's no it | 01:15 |
kanzure | hm | 01:15 |
kanzure | echo ! works though | 01:15 |
kanzure | oh | 01:15 |
fenn | are you doing double quotes? try single | 01:15 |
kanzure | ah | 01:16 |
kanzure | wget still says it is ambiguous though | 01:17 |
kanzure | wget --proxy-pass=hi! | 01:17 |
fenn | wget --proxy-pass='hi!' | 01:17 |
kanzure | right | 01:17 |
kanzure | even that | 01:17 |
fenn | it's --proxy-password | 01:18 |
kanzure | bleh | 01:18 |
kanzure | oh | 01:19 |
kanzure | I just realized something | 01:19 |
kanzure | Google pulls up numerous documents that are related to the title | 01:19 |
kanzure | so you have to do *exact* title searches | 01:19 |
kanzure | as in, intitle:"name" | 01:19 |
kanzure | where "name" is the name of the article | 01:19 |
kanzure | else you will get PDFs from other things | 01:19 |
kanzure | fenn: | 01:41 |
kanzure | http://search.cpan.org/dist/WWW-Mechanize/lib/WWW/Mechanize.pm#$mech->redirect_ok() | 01:41 |
kanzure | you think there's a way to figure out the 'current URL' that it is sitting at ? | 01:42 |
kanzure | ah, nevermind | 01:42 |
kanzure | fenn: Here's my regexp, II$r3 =~ '<a.*?href="(.*?)">.*?PDF.*?</a>'; | 01:57 |
kanzure | and here's what I need to match: <a title="Download PDF" class="articlenav2" target="_top" href="/nature/journal/v347/n6293/pdf/347539a0.pdf">Download PDF</a> | 01:57 |
kanzure | for some reason, I am only getting back "/nature/" ... | 01:57 |
fenn | dunno | 02:16 |
fenn | $1 = "/nature/" ? | 02:17 |
fenn | also print $r3 and make sure it's what you expect | 02:19 |
kanzure | of course | 02:20 |
kanzure | #perl has convinced me to switch to LinkExtractor | 02:20 |
kanzure | http://search.cpan.org/~podmaster/HTML-LinkExtractor-0.13/LinkExtractor.pm | 02:20 |
kanzure | now I'm figuring out how to access the _TEXT variable | 02:20 |
kanzure | foreach my $x ($LX->links) { $x->_TEXT; } or something ... | 02:21 |
fenn | huh. linkextractor just dumps you back in the same situation | 02:22 |
fenn | there's no variable containing 'I am a LINK!!!' | 02:23 |
kanzure | _TEXT is it. | 02:23 |
kanzure | you just have to strip out the HTML. | 02:23 |
fenn | then why bother with linkextractor :) | 02:24 |
kanzure | blah, #perl is telling me to go back to the newbie tutorials | 02:24 |
kanzure | I just want to get the _TEXT variable :( | 02:24 |
kanzure | I thought it might be $x{_TEXT} but that wasn't it either | 02:24 |
kanzure | it's a hashref, I know that much | 02:25 |
fenn | $LX->links{_TEXT}? | 02:26 |
fenn | for my $Link( @{ $LX->links } ) { | 02:26 |
fenn | ## new modules are linked by /author/NAME/Dist | 02:26 |
fenn | if( $$Link{href}=~ m{^\/author\/\w+} ) { | 02:26 |
fenn | print $$Link{_TEXT}."\n"; | 02:26 |
fenn | change author to PDF | 02:26 |
kanzure | bleh | 02:27 |
kanzure | well, not quite | 02:27 |
kanzure | $$Link{href} is assuming there's a pdf in the URL | 02:27 |
fenn | i forget how to get an element from an array | 02:27 |
fenn | oh, change href to _TEXT then | 02:28 |
fenn | and then print the href :) | 02:28 |
kanzure | yep | 02:29 |
kanzure | hm, there's a few other parts of the code I have to fix | 02:29 |
kanzure | because nature.com is a bitch and provides relative links | 02:29 |
kanzure | but that's simple enough | 02:29 |
kanzure | fenn: It works. | 02:52 |
kanzure | fenn: Two things to make note of. (1) If Google does not provide a link to a PDF, then the name of the PDF has to be the search string you used. This gets kind of nasty. Maybe there's a | 02:52 |
perl-PDF library that I can use that can extract the name of the paper. That would be really useful. | ||
kanzure | (2) Doesn't yet do a list of inputs, but this is easy. | 02:53 |
fenn | know anything about webs of trust? | 03:02 |
fenn | is it possible to 'import' a web that's already existing? for example robots.net or advogato | 03:02 |
kanzure | don't know what you are talking about | 03:04 |
fenn | if software doesn't work it's no big deal | 03:04 |
fenn | but say you have a big dependency tree leading up to some hardware project, that costs money and time and effort | 03:04 |
fenn | so you'd like to know in advance the trustworthiness of the author (in the field of the invention) | 03:05 |
fenn | there exist already, open systems to gauge the amount of trust an individual has acquired | 03:06 |
kanzure | http://heybryan.org/projects/autoscholar/ | 03:06 |
fenn | i'd like to be able to jump-start the system by finding the small-world center nodes (people) and asking them to join, but that takes a lot of work | 03:07 |
fenn | and they wont necessarily contribute to our project and become center nodes | 03:07 |
fenn | so it'd be better if we could use the whole web of trust from elsewhere that already exists | 03:08 |
fenn | rather than trying to build community and trust all over again for every web site | 03:08 |
fenn | i get annoyed about having to make new logins all the time | 03:09 |
kanzure | have you heard of OpenID? | 03:09 |
fenn | nope | 03:10 |
* fenn looks | 03:11 | |
kanzure | oh shit | 03:14 |
kanzure | yeah, that's a good thing to know about | 03:14 |
kanzure | http://claimid.com/ is what I use | 03:14 |
kanzure | but there are others out there | 03:14 |
kanzure | probably a few that are more legit | 03:14 |
fenn | lawdy.. forget i said anything about trust networks mmkay | 03:29 |
fenn__ | is it ironic that roderick long is an "ayn rand" scholar? http://en.wikipedia.org/wiki/Social_contract#Implicit_social_contract_theory_presupposes_its_conclusion | 04:16 |
-!- Irssi: Starting query in freenode2 with kanzure | 18:02 | |
kanzure | Hey | 18:02 |
kanzure | Thanks for that email, it reminded me to get into gear | 18:02 |
kanzure | let's make a database/repository for these projects, for "blackboxing" whole projects | 18:02 |
kanzure | we can begin by splitting up all sorts of projects into their units | 18:02 |
kanzure | and each package will include (1) some specs on what it does, (2) some variables on what can be changed, (3) an output in some "fabricator-friendly" format, and (4) a simulator to plug | 18:03 |
in to an overall program when you want to simulate your project | ||
kanzure | just like in APT or CPAN, you cannot specify functionality, which is unfortunate, but something that we just have to get over | 18:03 |
kanzure | also, I will be gone in 15 minutes, so think fast ;) | 18:03 |
fenn | uh, hi | 18:16 |
fenn | hello | 18:16 |
fenn | what do you mean 'blackboxing'? like depends on other packages (rather than generic functionality) | 18:17 |
fenn | based on my experience with python and hasattr(), specifying generic functionality is way cooler | 18:17 |
kanzure | what? | 18:28 |
kanzure | you'll have to tell me about that later | 18:28 |
kanzure | but basically you can't search for functionality with APT or even Google | 18:28 |
kanzure | you have to search for tags | 18:28 |
kanzure | or be able to talk with somebody who can give you a package name | 18:28 |
kanzure | bbl | 18:28 |
kanzure | Hey | 18:54 |
fenn | in python if you pass an object to a function, it will run it, no questions asked. you can examine the object either by type (i.e. package name) or by its attributes. by attributes is much | 18:56 |
more flexible and powerful | ||
fenn | if it's the wrong type of object, you'll get someting like 'error: "car" has no attribute "horsepower"' | 18:59 |
fenn | when it tries to access car.horsepower | 19:00 |
kanzure | yes, but you can't encode the actual functionality spec | 19:13 |
kanzure | bbl | 19:13 |
kanzure | What I was basically saying is that APT works out not because it has some super-awesome way of finding software, but rather it's a very well known database of software. We just need the | 22:30 |
same for all sorts of other projects, with ways of managing different fileformats and specifying what a module contains, but not necessarily its entire specification, just enough to | ||
allow somebody who has already found it to find it again. | ||
kanzure | This seems to be the same thing as the intelligence problem. You can't really select for it, but if you see it appear, you know to run with it. I think the way Andy copes with this is | 23:01 |
via artificial biochemistries ... he has added fake nucleic acids to what he calls "uncoli" (his variant of ecoli), which boosts the bacteria from 1/2000 chance of mutation to something | ||
much higher, like 10% chance of mutation, which allows very rapid communi | ||
Day changed to 21 Mar 2008 | ||
kanzure | hey | 15:29 |
kanzure | I found another "one of us" sort of guys | 15:29 |
kanzure | 'epitron' on freenode | 15:29 |
kanzure | he has a favorable condition where he has this giant gaping air pocket in his skull, suitable for a brain implant | 15:30 |
fenn | um, how did he figure that out? | 16:07 |
kanzure | MRI. | 16:07 |
kanzure | developed during fetal stage | 16:07 |
kanzure | http://chris.ill-logic.com/files/my_brain.zip | 16:08 |
kanzure | heh, "Chris Gahan - PROBLEM SOLVER" mentioned on his web page | 16:08 |
fenn | my mom knew a girl who was apparently completely normal except that her brain was just a thin smooth balloon | 16:08 |
kanzure | interesting | 16:09 |
kanzure | there was an article about a man like that | 16:09 |
kanzure | he recently died, they investigated his brain, it was also a thin sliver | 16:09 |
kanzure | http://chris.ill-logic.com/wiki/CurriculumVitae | 16:09 |
kanzure | he happens to do engineering psych | 16:10 |
kanzure | so he's on the "self-modification" level | 16:10 |
kanzure | whereas I'd call you more self-replication ;) | 16:10 |
fenn | sure | 16:12 |
fenn | i have no tattoos | 16:12 |
kanzure | we need to figure out a way to make a "Getting up to speed" page | 16:12 |
kanzure | or at least a way to list the guys "like us". I'd list you, myself, BioMors, Superkuh, enki-2, epitron, and a few others that I may be forgetting | 16:13 |
kanzure | Maybe TheWOLPRO or endos127, but they seem to be too wrapped up in school to care | 16:13 |
fenn | surely there are many others, we are just the ones on freenode | 16:13 |
kanzure | right | 16:14 |
kanzure | but I bet there are many others who would be interested in contributing | 16:14 |
kanzure | if they had, say, a map | 16:14 |
fenn | 1) define the problem. 2) solve the problem | 16:14 |
kanzure | http://heybryan.org/mediawiki/index.php/Getting_up_to_speed <-- I am going to dump some notes here. | 16:14 |
fenn | i think solar concentrators can provide sufficient energy to do small scale foundry work | 16:16 |
kanzure | giant mirrors? | 16:16 |
fenn | steel casting.. can't do that any other way except with huge amounts of electricity | 16:16 |
fenn | arrays of small mirrors | 16:17 |
kanzure | Tesla used to use the earth for electricity and so on | 16:17 |
kanzure | it would be useful if we could do the same with giant asteroids | 16:17 |
fenn | well, i dont know how to do that | 16:17 |
kanzure | neither do I. | 16:17 |
kanzure | giant solar cell arrays may have to be the solution | 16:17 |
kanzure | many square kilometers | 16:17 |
kanzure | not a big deal, IMO, if you have self-replication | 16:18 |
fenn | oh, actually i'm wrong, you can melt steel with an oxygen concentrator | 16:18 |
kanzure | unless that needs steel foundry | 16:18 |
kanzure | oh, good | 16:18 |
fenn | i was reading this and thinking about how to do it with a 'fresnel mirror' for both mirrors http://kmr.nada.kth.se/wiki/Main/PointFocus | 16:18 |
kanzure | *.kth.se is good | 16:19 |
kanzure | http://www.nada.kth.se/~asa/ <-- Anders Sandberg. | 16:19 |
fenn | interesting | 16:19 |
kanzure | he used to run the Omega Point Society in Sweden. | 16:19 |
fenn | the guy who wrote that paper is now head of the department(?) and doing research on "the semantic web" | 16:19 |
kanzure | Anders is a good guy to get on board, he does lots of free form fabrication stuff too | 16:20 |
kanzure | and used to do lots of TransVision conferences | 16:20 |
kanzure | saw him last week in Second Life. | 16:20 |
kanzure | hm | 17:25 |
kanzure | http://wiki.ill-logic.com/AugmentationNotAutomation | 17:25 |
fenn | agreed, but why the title "Augmentation Not Automation"? | 17:45 |
kanzure | automation is subset of augmentation | 17:56 |
fenn | huh. "learning depends on social interaction" is quite true but i had never noticed | 18:13 |
kanzure | yeah | 19:00 |
kanzure | which sucks | 19:00 |
kanzure | I would desperately like to prove otherwise | 19:00 |
fenn | perhaps you could substitute randomness (weighted with a model of your interests of course) | 19:01 |
fenn | but that's television | 19:02 |
kanzure | had to bring epitron up to speed http://heybryan.org/chats/epitron-2008-03-21.html | 20:01 |
kanzure | http://heybryan.org/shots/img_8032.jpg | 21:19 |
kanzure | hm, http://knome.org/ as a 23andme/decodeme clone | 22:27 |
kanzure | Found this hidden on my site -- http://heybryan.org/creating_communities.html how to make communities | 23:09 |
fenn | yep that's why i mistakenly thought you were 22 | 23:13 |
kanzure | hm? how's that? | 23:13 |
fenn | scroll down to Throwaway identities | 23:14 |
kanzure | ooh | 23:14 |
kanzure | note the quotes | 23:14 |
fenn | i dont like how a lot of those are essentially advocating spamming | 23:15 |
kanzure | :( | 23:15 |
kanzure | it's kind of weird, though, because it kind of worked for me: I published an email announcing my biohacking kit, and I had to spread it *myself* | 23:16 |
kanzure | I had to go push it on to the news websites | 23:16 |
kanzure | I had to push it to Make, to hackaday, etc., | 23:16 |
kanzure | the only way to not have to push is to go through AP and they do 'serious' stuff (supposedly) | 23:16 |
fenn | sure | 23:16 |
fenn | Hypermarketer website/tool- automated emails, rss feeds with "updates" on the outbreak, spam email from botnet, multiple fake accounts on all of the popular social networking or "web 2.0" | 23:17 |
sites, mediablitz, all within one hour, with continued postings throughout the internet to *take over* the smaller blogs if necessary. Goal: no trail to an original, single source. To | ||
really fool anybody who might be catching on, have multiple emails across the botnet submitted at the same moment with clocks in synch. | ||
fenn | is that really something you want to be associated with? | 23:17 |
kanzure | not really | 23:17 |
fenn | anyway it starts out good | 23:18 |
kanzure | I was just doing note taking, mind you | 23:18 |
kanzure | plus some brain storming ;) | 23:18 |
fenn | a lot of people put basically zero effort into publicizing themselves though, understandably | 23:18 |
kanzure | oh, by the way | 23:19 |
kanzure | I have a question | 23:19 |
fenn | nobody ever said 'in moderation' was easy | 23:19 |
kanzure | let's say that by some miracle I have figured out a way to hack DNA replication and can make ssDNA while inside a cell | 23:19 |
kanzure | and I know that the cell will degrade it immediately | 23:19 |
kanzure | however, | 23:19 |
kanzure | do you know of any 'molecular chaperones' that could bring it to the plasma membrane and push it through? | 23:19 |
fenn | not DNA but there are lots of them for RNA | 23:19 |
fenn | why would you want to make ss DNA? | 23:20 |
kanzure | ssDNA does logic gates | 23:20 |
kanzure | RNA logic gates are infeasible (apparently) | 23:20 |
fenn | uh, i thought you needed dsDNA for your scheme | 23:20 |
kanzure | I have a plasma-membrane-bound SSBP | 23:20 |
kanzure | I thought it was ssDNA | 23:20 |
kanzure | http://heybryan.org/winfree.html | 23:21 |
kanzure | yeah, ssDNA | 23:21 |
kanzure | anyway, I have a SSBP that I can express on the outer surface | 23:21 |
fenn | no, pretty sure the rna gets transcribed by regular RNA polymerase (which uses ds DNA) | 23:21 |
kanzure | which will bind to the ssDNA | 23:21 |
kanzure | oh | 23:22 |
kanzure | okay, so a dsDNA template is used for the switch itself | 23:22 |
kanzure | and then ssDNA for the activator for completing the promoter region or something | 23:22 |
kanzure | anyway, dsDNA then. | 23:22 |
fenn | you want to truck ds DNA around? probably easier in a bacterial cell | 23:23 |
fenn | they do that sort of thing for 'mating' | 23:23 |
kanzure | yepo | 23:23 |
kanzure | *yep | 23:23 |
kanzure | so that's what I am figuring. | 23:23 |
kanzure | I just need a dsDNA chaperone molecule to truck it to the membrane and then bind it to it (SSBP-- this is used in bacterial transformation apparently, as part of competence) | 23:24 |
kanzure | I want to encode the dsDNA logic gate strands into the genome, but that's another story -- I actually want the nucleotides to encode *which* logic to use for each gate, then have another | 23:25 |
part come in and swap in the actual gate (AND, OR, NOR, XOR, ...) while conserving the number of used gates (for various technicalities) | ||
kanzure | this is all so that I can evolve logic that has some 'emergent' property | 23:26 |
kanzure | since I can't come up with anything for Andy. heh' | 23:26 |
fenn | so this would be like 'programmable' logic gates? | 23:26 |
kanzure | yes, I suppose that's true | 23:27 |
kanzure | is that how an FPGA works? | 23:27 |
kanzure | having a conserved number of gates, but you get to choose the pathways between them or something? | 23:27 |
fenn | an fpga has a memory element that controls the function of the gate (and, or, etc) | 23:27 |
fenn | you are very limited in choosing what gate connects to what other gates | 23:27 |
fenn | its more like a grid than a brain | 23:28 |
kanzure | ah, so this is almost the same thing | 23:28 |
kanzure | except the memory is on the genome | 23:29 |
kanzure | wait, same thing | 23:29 |
kanzure | I am sure of it. | 23:29 |
fenn | "have another part come in and swap in the actual gate" could you elaborate on what 'another part is' and how to 'swap in' the gate function? | 23:29 |
fenn | like the DNA is the compressed version of the gate, and something comes along and rewrites the DNA macro? | 23:30 |
fenn | expands the macro | 23:30 |
fenn | do you know about introns and exons? | 23:31 |
kanzure | somewhat, not enough | 23:35 |
kanzure | as for the elaboration: Andy's lab has done this with nucleic acids. He has evolved unnatural amino acids and nucleic acids, plus the enzymes required for DNA replication with those new | 23:37 |
units; so if you have an encoding representing AND, OR, NOT, then instead of the amino acid you have the dsDNA come up. The dsDNA can be made by replicating a portion of the DNA molecule | ||
that specifies how to make the gates. (eof) | ||
fenn | you cant make DNA with a ribosome though? | 23:40 |
kanzure | don't know | 23:40 |
kanzure | that would be useful | 23:40 |
fenn | you could do lots of splicing with mRNA using introns/exons and then reverse-transcriptase it back to DNA | 23:40 |
kanzure | splicing inside of the cell? | 23:41 |
fenn | yes | 23:41 |
fenn | dna-splicing tools are generally implements of war | 23:41 |
kanzure | hrm | 23:41 |
fenn | not something a cell would do in the course of everyday housekeeping | 23:41 |
fenn | i think it's funny that people call bacteria 'species' | 23:47 |
Day changed to 22 Mar 2008 | ||
kanzure | http://en.wikibooks.org/wiki/Circuit_Idea/How_do_We_Create_Sinusoidal_Oscillations%3F <-- somebody has put a lot of work into this article | 00:22 |
fenn | i wonder who | 00:24 |
fenn | wiki's are cool but i dont see any reason behind doing a lot of work and not putting your name on it somewhere | 00:25 |
kanzure | http://en.wikibooks.org/wiki/Circuit_Idea | 00:26 |
kanzure | this entire book is peculiar | 00:26 |
kanzure | it's right on | 00:26 |
kanzure | all about the social knowledge of electronic circuits | 00:26 |
fenn | i'm glad something is working. the old electronics collaborative book was festering | 00:28 |
kanzure | here's the guy's website | 00:28 |
kanzure | http://www.circuit-fantasia.com/ | 00:28 |
kanzure | http://www.circuit-fantasia.com/circuit_stories/inventing_circuits/inventing_list_of_circuits.htm lots of content | 00:29 |
fenn | *shudder* | 00:29 |
fenn | make it stop! | 00:29 |
fenn | black boxing = hiding : http://en.wikibooks.org/wiki/Circuit_Idea/Why_Circuit_Ideas_are_Hidden | 01:19 |
-!- kanzure: No such nick/channel | 01:19 | |
-!- kanzure [n=bryan@cpe-70-113-54-112.austin.res.rr.com] | 01:19 | |
-!- was : purple | 01:19 | |
-!- server : irc.freenode.net [Sat Mar 22 04:33:19 2008] | 01:19 | |
-!- End of WHOWAS | 01:19 | |
kanzure | http://heybryan.org/mediawiki/index.php/Socialized_engineering_knowledge_database | 12:57 |
kanzure | if you'd like to drop some notes. | 12:57 |
kanzure | huh, I think you are, in fact, the bottleneck - http://heybryan.org/mediawiki/index.php/Getting_up_to_speed | 13:22 |
kanzure | also, I noted your recent-changes on your wiki and will want to talk about amorphous fabrication + cells later, I am pretty sure cells are not the replicators that we need since they | 13:23 |
can't specifically manufacture in "solid-state" sense | ||
kanzure | although ultimately since we are biological, and we have constructed these machines, we know that it should be possible to make more biological systems to produce such machines as the | 13:24 |
ones we see before us, | ||
kanzure | but that's pretty hard in general, since it required extensive training of the humans | 13:24 |
fenn | http://en.wikibooks.org/wiki/Circuit_Idea/Why_Circuit_Ideas_are_Hidden <- every time you say 'blackboxing' i think of this | 14:17 |
fenn | i want open source hardware, and more than that, open knowledge | 14:17 |
kanzure | right | 14:17 |
kanzure | blackboxing just means "for now, we avoid this component and act like we know what it is" | 14:18 |
kanzure | and in many cases, the ideas are hidden to make the box/circuit | 14:18 |
kanzure | although hopefully we can change that | 14:18 |
fenn | could we call it 'scrounging' or 'outsourcing' instead? | 14:18 |
kanzure | sure | 14:18 |
kanzure | http://heybryan.org/mediawiki/index.php/Blackbox | 14:19 |
kanzure | done | 14:19 |
fenn | hextatic is actually aimed more at empowerment of the individual than turning into a swarm of self-replicators | 14:21 |
fenn | it just happens that i can't think of a better starting point for a self replicator | 14:21 |
kanzure | we need to do a mega outline brain storming session for what is needed to make a self-replicator, once and for all | 14:23 |
fenn | maybe it would be better to call it 'environment modification' | 14:23 |
kanzure | how's that? | 14:23 |
fenn | because the goal of having a self-replicator is to do stuff with it | 14:23 |
fenn | like make a floating sky palace or whatever | 14:23 |
fenn | after all, it's not me that's replicating. i can do that already, just need to find a suitable female | 14:24 |
fenn | and/or sheep and biotech lab :P | 14:25 |
kanzure | right | 14:25 |
kanzure | so I see what you mean | 14:26 |
kanzure | a tool to help extend the environments in which we (as von Neumann replicators already) can work in | 14:26 |
kanzure | or to help increase the number of environments in which we can setup and install ourselves | 14:26 |
fenn | yes | 14:27 |
kanzure | it is interesting that even though we are biological, we have somehow been able to do solid state devices, even though our biology is quite 'fuzzy' | 14:27 |
kanzure | so that gives hope that we can do fuzzy biological systems that will make solid state devices | 14:27 |
kanzure | unless we want to do a self-replicator without an internal dependency on biology | 14:27 |
fenn | i want to do a self-replicator without an internal dependence on biology | 14:28 |
fenn | the dna tile thing was just a clever shortcut | 14:28 |
kanzure | hrm | 14:28 |
fenn | i didn't anticipate it | 14:28 |
fenn | the idea was 'computers are the most complex thing out there, so if we can make one of them, we can make anything' | 14:28 |
fenn | turns out that's not true | 14:28 |
kanzure | if you do want to do it without biology, then what's with your "environment modification"-tool ? | 14:29 |
fenn | i'm a selfish greedy gene | 14:29 |
fenn | and so are the other 7 billion humans | 14:29 |
fenn | if i want their help, it has to be relevant for them too | 14:30 |
fenn | otherwise you have stuff like the artist christo - decorating islands in pink plastic | 14:30 |
fenn | http://www.christojeanneclaude.net/si.shtml | 14:31 |
fenn | also i feel like using biology is cheating. you dont really truely understand how it works until you've made it from scratch | 14:32 |
kanzure | so my previous method of getting started on a von neumann probe project is (in my opinion) still working pretty well: I defined what was needed and then was going to work backwards | 14:32 |
("Humans would need these resources") | ||
kanzure | so let's do that same thing but without the biological component | 14:32 |
kanzure | and since this opens up too many doors at the same time | 14:33 |
kanzure | let's add in some constraints, namely mineral constraints | 14:33 |
kanzure | let's go find out what asteroids commonly have in them, and then figure out a way to do self-replication with the processing of those materials | 14:33 |
fenn | let's not add artificial constraints | 14:33 |
kanzure | then we'd have to have an "everything fabricator" and an "everything tool" | 14:33 |
fenn | there will be multiple ways to do it, why start with asteroids when we are on earth? | 14:33 |
kanzure | well, I just mean to propose that scenario | 14:34 |
kanzure | where resources are obviously limited | 14:34 |
kanzure | and you don't have to make a tool to process every possible mineral | 14:34 |
fenn | there are asteroids full of nickel and platinum.. the resources aren't limited they're just different | 14:34 |
fenn | i think we should try to make use of glass because the stuff is everywhere | 14:35 |
fenn | and ceramics | 14:35 |
kanzure | but didn't you just say you didn't want to constrain the possibilities? ;) | 14:36 |
fenn | i'm advocating their use, not saying everything else is off limits | 14:36 |
fenn | perhaps it's possible to make silicone rubber from raw minerals? | 14:38 |
kanzure | sure, it would have to be | 14:38 |
fenn | i mean easily, without an army of chemists and refineries :) | 14:38 |
fenn | we have to do it first by hand before programming the machine to do it | 14:39 |
kanzure | correct | 14:42 |
kanzure | what would silicone rubber be used for? | 14:42 |
kanzure | and what other resources would you be considering for inclusion ? | 14:42 |
fenn | insulation, gaskets and seals, lubrication | 14:42 |
fenn | i'm also thinking about aluminum | 14:43 |
kanzure | what is the fabricator of this design? | 14:43 |
fenn | do you notice a common theme? (i do) | 14:43 |
kanzure | sort of, looks mechanical or vacuum-tube based | 14:43 |
fenn | well, maybe. but it all comes from clay-like and sandy soil | 14:43 |
fenn | clay is aluminum magnesium silicate | 14:45 |
fenn | aluminum would be much more 'expensive' to manufacture because it requires hydrochloric acid (and where do you get the chlorine?) | 14:46 |
kanzure | let's wiki it | 14:46 |
kanzure | http://heybryan.org/mediawiki/index.php/Clay-sand-soil_replicator | 14:46 |
kanzure | I just jotted down some notes | 14:47 |
kanzure | let's do something like this | 14:51 |
kanzure | http://en.wikipedia.org/wiki/Image:Advanced_Automation_for_Space_Missions_figure_5-29.gif | 14:51 |
kanzure | this is the one where arms pick up parts from a shelf | 14:51 |
kanzure | and then assemble the parts into the replicator | 14:51 |
fenn | yeah looks really advanced ~~ | 14:52 |
kanzure | then we can add functionality where the arms can retrieve the parts or store the parts onboard | 14:52 |
kanzure | where the 'parts' are really just material resources | 14:52 |
fenn | oh, as an experimental phase? instead of actually digging dirt you just give it glass and clay? | 14:53 |
kanzure | so if we have a 'number of parts' we can then go back and jot down all required machinery to make that particular part (to process the raw mineral-resources), and then if we want to do | 14:53 |
good then we have to optimize all of that machinery to use the same resources and be made from the same arm-manipulator | ||
kanzure | yeah | 14:53 |
kanzure | eventually we should just give it input such as a bucket of sand | 14:54 |
kanzure | and then further down the road we make it walk outside and search for the bucket of sand | 14:54 |
kanzure | (or whatever would be a good debug-test for searching for raw minerals) | 14:54 |
fenn | i find myself reluctant to add carbon to the list for some reason | 15:05 |
fenn | i think this is too complicated to do on a wiki | 15:05 |
kanzure | can it be done on paper? | 15:06 |
fenn | there are lots of interconnections, and at different levels | 15:06 |
kanzure | here are my notes on the "contractionary design approach" - http://heybryan.org/mediawiki/index.php/Self-replication#The_.22contractory_phase.22_design_approach | 15:06 |
kanzure | yeah | 15:06 |
fenn | maybe it needs a whole namespace instead of just a page | 15:06 |
fenn | why disassembly? i dont think it's necessary for self replication, just makes for a more efficient ecology | 15:12 |
kanzure | no, dissassembly for *designing* it | 15:12 |
kanzure | the actual machine need not be able to dissassemble itself | 15:12 |
fenn | in Hierarchy of self-reppers | 15:13 |
kanzure | ah, I was thinking about how cells seem to be self-destructive when they replicate | 15:14 |
kanzure | some species breed and then just die afterwards | 15:14 |
kanzure | they expend lots of energy in the process and sometimes cut their resources in half | 15:15 |
kanzure | which is something that can't be fixed, in general, unless they go get more resources etc. | 15:15 |
fenn | wasteful | 15:15 |
fenn | i read about an alien bacterial life form (possibly fictional?) that replicated by building miniature copies inside of the cell, when then burst open | 15:17 |
fenn | i can see the sense in that | 15:17 |
fenn | but afaik all earthian animals can lay eggs/do mitosis | 15:17 |
fenn | spores, seeds, rhizomes | 15:18 |
kanzure | isn't there some insect that lays eggs inside her body and is eaten from the inside out for the larvae to survive? | 15:18 |
fenn | not that i know of, but i'd be interested if you have a link | 15:18 |
fenn | ping | 15:25 |
fenn | i've not heard of this insect | 15:25 |
fenn | no i've not heard of this insect | 15:26 |
kanzure | gah | 15:27 |
kanzure | http://69.180.166.50/old/_/files/operaessions_0.jpg | 15:27 |
kanzure | Superkuh gets kinda extreme. | 15:27 |
kanzure | so from the look of the http://heybryan.org/mediawiki/index.php/Clay-sand-soil_replicator page it looks like you're going in the opposite direction that I was proposing (which isn't bad, | 15:41 |
I'm just observing) | ||
kanzure | particularly, you're starting with basic minerals and then specifying what can be made from them | 15:41 |
kanzure | and then I guess you're just hoping that you started with the right mix of minerals to make machinery that can use all of them ? | 15:41 |
kanzure | ./join #hplusroadmap | 15:44 |
kanzure | I didn't mean to pull you away from work, I thought epitron was solid | 16:00 |
fenn | hah | 16:01 |
fenn | you thought i was solid? :) | 16:02 |
kanzure | what? | 16:02 |
kanzure | well sure, you seem to have enough background to be able to make yourself do work | 16:02 |
-!- kanzure [n=bryan@cpe-70-113-54-112.austin.res.rr.com] | 16:23 | |
-!- ircname : purple | 16:23 | |
-!- channels : @#hplusroadmap #biology ##neuroscience #bioinformatics @#namcub #wrongplanet @##wikipeding | 16:23 | |
-!- server : irc.freenode.net [http://freenode.net/] | 16:23 | |
-!- : is identified to services | 16:23 | |
-!- End of WHOIS | 16:23 | |
fenn | a shill? | 16:23 |
kanzure | hm? | 16:24 |
fenn | purple :) | 16:24 |
-!- Irssi: Looking up irc.freenode.net | 17:48 | |
-!- Irssi: Connecting to irc.freenode.net [140.211.166.3] port 6667 | 17:48 | |
-!- Irssi: Connection to irc.freenode.net established | 17:48 | |
!irc.freenode.net *** Looking up your hostname... | 17:48 | |
!irc.freenode.net *** Checking ident | 17:48 | |
!irc.freenode.net *** No identd (auth) response | 17:48 | |
!irc.freenode.net *** Found your hostname | 17:48 | |
-!- Welcome to the freenode IRC Network pz | 17:48 | |
-!- Your host is zelazny.freenode.net[zelazny.freenode.net/6667], running version hyperion-1.0.2b | 17:48 | |
!zelazny.freenode.net *** Your host is zelazny.freenode.net[zelazny.freenode.net/6667], running version hyperion-1.0.2b | 17:48 | |
-!- This server was created Sat May 19 03:15:54 UTC 2007 | 17:48 | |
-!- zelazny.freenode.net hyperion-1.0.2b aAbBcCdDeEfFGhHiIjkKlLmMnNopPQrRsStTuUvVwWxXyYzZ01234569*@ bcdefFhiIklmnoPqstv | 17:48 | |
-!- IRCD=dancer CAPAB CHANTYPES=# EXCEPTS INVEX CHANMODES=bdeIq,k,lfJD,cgijLmnPQrRstz CHANLIMIT=#:20 PREFIX=(ov)@+ MAXLIST=bdeI:50 MODES=4 STATUSMSG=@ KNOCK NICKLEN=16 are supported by this server | 17:48 | |
-!- SAFELIST CASEMAPPING=ascii CHANNELLEN=30 TOPICLEN=450 KICKLEN=450 KEYLEN=23 USERLEN=10 HOSTLEN=63 SILENCE=50 are supported by this server | 17:48 | |
-!- There are 24761 listed and 19580 unlisted users on 27 servers | 17:48 | |
-!- 43 flagged staff members | 17:48 | |
-!- 19595 channels formed | 17:48 | |
-!- I have 3934 clients and 0 servers | 17:48 | |
-!- Current local users: 3934 Max: 4302 | 17:48 | |
-!- Current global users: 44341 Max: 46091 | 17:48 | |
-!- Highest connection count: 4304 (4302 clients) (650635 since server was (re)started) | 17:48 | |
-!- - zelazny.freenode.net Message of the Day - | 17:48 | |
-!- - zelazny.freenode.net Message of the Day - | 17:48 | |
-!- - Welcome to zelazny.freenode.net in Corvallis, Oregon, US! Thanks to | 17:48 | |
-!- - Oregon State University for sponsoring this server! | 17:48 | |
-!- - | 17:48 | |
-!- - ZELAZNY, ROGER JOSEPH [1937-1995]. Roger Zelazny was a | 17:48 | |
-!- - leading light in the New Wave of science fiction. He began | 17:48 | |
-!- - writing in 1962. Known for such works as This Immortal, | 17:48 | |
-!- - Lord of Light, The Dream Master and the Amber books, | 17:48 | |
-!- - Zelazny is best known for his idiomatic American | 17:48 | |
-!- - protagonists, embodying the mythological figures of the | 17:48 | |
-!- - Trickster and the Hero of a Thousand Faces. | 17:48 | |
-!- - | 17:48 | |
-!- - You're using freenode, a service of Peer-Directed Projects | 17:48 | |
-!- - Center (http://freenode.net/pdpc.shtml). | 17:48 | |
-!- - | 17:48 | |
-!- - By connecting to freenode you indicate that you have read | 17:48 | |
-!- - and agree to adhere to our policies and procedures as per | 17:48 | |
-!- - the website (http://freenode.net). We would like to remind | 17:48 | |
-!- - you that unauthorized public logging of channels on the | 17:48 | |
-!- - network is prohibited. Public channel logging should only | 17:48 | |
-!- - take place where the channel owner(s) has requested this | 17:48 | |
-!- - and users of the channel are all made aware (if you are | 17:48 | |
-!- - publically logging your channel, you may wish to keep a | 17:48 | |
-!- - notice in topic and perhaps as a on-join message). | 17:48 | |
-!- - | 17:48 | |
-!- - By registering your nickname with Nickserv you agree that you | 17:48 | |
-!- - are 13 years of age, or older. For more information about the | 17:48 | |
-!- - Children's Online Privacy Protection Act please see their | 17:48 | |
-!- - website at (http://www.coppa.org). | 17:48 | |
-!- - | 17:48 | |
-!- - freenode runs an open proxy scanner. Your use of the network | 17:48 | |
-!- - indicates your acceptance of this policy. For details on | 17:48 | |
-!- - freenode network policy, please take a look at our policy | 17:48 | |
-!- - page (http://freenode.net/policy.shtml). Thank you for using | 17:48 | |
-!- - the network! | 17:48 | |
-!- - | 17:48 | |
-!- - freenode is a service of Peer-Directed Projects Center, an | 17:48 | |
-!- - IRS 501(c)(3) not-for-profit organization. Our yearly | 17:48 | |
-!- - fundraiser will begin soon; if you'd like to donate early, | 17:48 | |
-!- - please see http://freenode.net/pdpc_donations.shtml for more | 17:48 | |
-!- - information. Thank you for using freenode! | 17:48 | |
-!- End of /MOTD command. | 17:48 | |
freenode-connect [freenode@freenode/bot/connect] requested CTCP VERSION from pz: | 17:48 | |
-NickServ(NickServ@services.)- This nickname is owned by someone else | 17:48 | |
-NickServ(NickServ@services.)- If this is your nickname, type /msg NickServ IDENTIFY <password> | 17:48 | |
-!- Mode change [+i] for user pz | 17:48 | |
-!- Irssi: Unknown command: log show | 17:48 | |
-!- Irssi: Unknown command: log list | 17:48 | |
Logs: | 17:48 | |
1 /home/fenn/irclogs/hplusroadmap.log: ALL -autoopen | 17:48 | |
17:49 | ||
LOG OPEN [-noopen] [-autoopen] [-window] [-<server tag>] [-targets <targets>] [-colors] <fname> [<levels>] | 17:49 | |
LOG CLOSE <id>|<file> | 17:49 | |
LOG START <id>|<file> | 17:49 | |
LOG STOP <id>|<file> | 17:49 | |
17:49 | ||
-noopen: Create the entry to log list, but don't start logging | 17:49 | |
-autoopen: Automatically open this log file at startup | 17:49 | |
-<server tag>: Targets are logged only in this server | 17:49 | |
-targets: Log only in specified channels/nicks (space separated list) | 17:49 | |
-window: Log output in the window. Active window is used by default, or | 17:49 | |
you can give the window's refnum in -targets. | 17:49 | |
<filename>: File name where to log, it is parsed with | 17:49 | |
strftime(), so %d=day, etc. see "man strftime" for | 17:49 | |
more info. | 17:49 | |
<levels>: Defaults to ALL | 17:49 | |
<id>: ID number of log. | 17:49 | |
17:49 | ||
/SET log_create_mode <mode> - Specifies what file mode to use with | 17:49 | |
the created log files. Default is 0644. | 17:49 | |
17:49 | ||
All of these are parsed with strftime(): /SET log_timestamp <text> - Specifies the time stamp format. | 17:49 | |
Default is "%H:%M ". | 17:49 | |
/SET log_open_string <text> - Text written to log when it's opened /SET log_close_string <text> - Text written to log when it's closed /SET log_day_changed <text> - Text written to log when day changes | 17:49 | |
17:49 | ||
NOTE: Log files are locked after opened, so two Irssis can't accidentally try to write to the same log file. | 17:49 | |
17:49 | ||
Examples: | 17:49 | |
17:49 | ||
/LOG OPEN -targets cras ~/irclogs/cras.log MSGS | 17:49 | |
- Logs all messages from/to nick `cras' | 17:49 | |
17:49 | ||
/LOG OPEN -targets #linux ~/irclogs/linux/linux-%Y-%m-%d | 17:49 | |
- Logs all messages in channel #linux. Log is rotated daily, so | 17:49 | |
logs in 1. May 2000 goes to file "linux-2000-05-01", when the | 17:49 | |
day is changed, Irssi closes the log and starts logging to | 17:49 | |
"linux-2000-05-02" etc. | 17:49 | |
17:49 | ||
See also: SET LOG, WINDOW LOG | 17:49 | |
17:49 | ||
Irssi commands: | 17:49 | |
log close log open log start log stop | 17:49 | |
--- Log closed Mon Mar 24 17:49:19 2008 | ||
--- Log opened Mon Mar 24 17:50:27 2008 | ||
-!- fenn [n=pz@adsl-76-251-84-177.dsl.bltnin.sbcglobal.net] has joined #hplusroadmap | 17:50 | |
-!- Topic for #hplusroadmap: happy bunny day - day of the replicator! | 17:50 | |
-!- Topic set by fenn [] [Sun Mar 23 22:34:25 2008] | 17:50 | |
[Users #hplusroadmap] | 17:50 | |
[ Enki-2] [ epitron] [ fenn] [ kanzure] | 17:50 | |
-!- Irssi: #hplusroadmap: Total of 4 nicks [0 ops, 0 halfops, 0 voices, 4 normal] | 17:50 | |
-!- Channel #hplusroadmap created Sat Mar 22 15:44:12 2008 | 17:50 | |
-!- Irssi: Join to #hplusroadmap was synced in 0 secs | 17:50 | |
fenn | meep | 17:51 |
kanzure | beep | 17:53 |
fenn | kanzure: have you seen n55? http://www.n55.dk/MANUALS/Manuals.html | 17:57 |
kanzure | No, hold on | 17:58 |
kanzure | fenn: I just found out about this: http://wiki.workatjelly.com/Jelly-Austin-March-25-2008 | 17:58 |
kanzure | I think I'll go. | 17:58 |
fenn | constructive work in a bar? yeah, sure | 17:59 |
fenn | are you going to sneak in? :) | 18:00 |
kanzure | oh, a bar | 18:09 |
kanzure | shit | 18:09 |
kanzure | fenn: I don't get n55 | 18:10 |
fenn | it's a technology distribution | 18:10 |
kanzure | is it? | 18:10 |
kanzure | it looks like a recursive self-defining manual | 18:10 |
fenn | aimed at the functionality required for living as a human on earth | 18:10 |
kanzure | hm | 18:11 |
fenn | it's also an art project, which helps in some ways and hurts in others | 18:11 |
fenn | i wish FACTORY was capable of making those damn plastic octahedron tanks | 18:13 |
fenn | apparently it's a lot easier to get them made in denmark | 18:14 |
-!- fenn_ [n=pz@adsl-76-251-87-49.dsl.bltnin.sbcglobal.net] has joined #hplusroadmap | 20:08 | |
-!- Topic for #hplusroadmap: happy bunny day - day of the replicator! | 20:08 | |
-!- Topic set by fenn [] [Sun Mar 23 22:34:25 2008] | 20:08 | |
[Users #hplusroadmap] | 20:08 | |
[ Enki-2] [ epitron] [ fenn] [ fenn_] [ kanzure] | 20:08 | |
-!- Irssi: #hplusroadmap: Total of 5 nicks [0 ops, 0 halfops, 0 voices, 5 normal] | 20:08 | |
-!- Channel #hplusroadmap created Sat Mar 22 15:44:12 2008 | 20:08 | |
-!- [freenode-info] if you need to send private messages, please register: http://freenode.net/faq.shtml#privmsg | 20:08 | |
-!- Irssi: Join to #hplusroadmap was synced in 12 secs | 20:08 |
Generated by irclog2html.py 2.9.2 by Marius Gedminas - find it at mg.pov.lt!